ID: 1091997384

View in Genome Browser
Species Human (GRCh38)
Location 12:5004386-5004408
Sequence ACTAGGGTCCACAGTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091997384_1091997388 3 Left 1091997384 12:5004386-5004408 CCAGTTTCACTGTGGACCCTAGT No data
Right 1091997388 12:5004412-5004434 AGGCTAGCCCTTATGAATCCAGG No data
1091997384_1091997390 10 Left 1091997384 12:5004386-5004408 CCAGTTTCACTGTGGACCCTAGT No data
Right 1091997390 12:5004419-5004441 CCCTTATGAATCCAGGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091997384 Original CRISPR ACTAGGGTCCACAGTGAAAC TGG (reversed) Intergenic
No off target data available for this crispr