ID: 1091997388

View in Genome Browser
Species Human (GRCh38)
Location 12:5004412-5004434
Sequence AGGCTAGCCCTTATGAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091997383_1091997388 6 Left 1091997383 12:5004383-5004405 CCGCCAGTTTCACTGTGGACCCT No data
Right 1091997388 12:5004412-5004434 AGGCTAGCCCTTATGAATCCAGG No data
1091997384_1091997388 3 Left 1091997384 12:5004386-5004408 CCAGTTTCACTGTGGACCCTAGT No data
Right 1091997388 12:5004412-5004434 AGGCTAGCCCTTATGAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091997388 Original CRISPR AGGCTAGCCCTTATGAATCC AGG Intergenic
No off target data available for this crispr