ID: 1091997390

View in Genome Browser
Species Human (GRCh38)
Location 12:5004419-5004441
Sequence CCCTTATGAATCCAGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091997387_1091997390 -7 Left 1091997387 12:5004403-5004425 CCTAGTGCTAGGCTAGCCCTTAT No data
Right 1091997390 12:5004419-5004441 CCCTTATGAATCCAGGATCCTGG No data
1091997383_1091997390 13 Left 1091997383 12:5004383-5004405 CCGCCAGTTTCACTGTGGACCCT No data
Right 1091997390 12:5004419-5004441 CCCTTATGAATCCAGGATCCTGG No data
1091997384_1091997390 10 Left 1091997384 12:5004386-5004408 CCAGTTTCACTGTGGACCCTAGT No data
Right 1091997390 12:5004419-5004441 CCCTTATGAATCCAGGATCCTGG No data
1091997386_1091997390 -6 Left 1091997386 12:5004402-5004424 CCCTAGTGCTAGGCTAGCCCTTA No data
Right 1091997390 12:5004419-5004441 CCCTTATGAATCCAGGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091997390 Original CRISPR CCCTTATGAATCCAGGATCC TGG Intergenic
No off target data available for this crispr