ID: 1091998215

View in Genome Browser
Species Human (GRCh38)
Location 12:5011849-5011871
Sequence ATGGAGAAGCAGAATCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1091998210_1091998215 5 Left 1091998210 12:5011821-5011843 CCAGTGGGTGTTTTCCCCTATTT No data
Right 1091998215 12:5011849-5011871 ATGGAGAAGCAGAATCAAAGAGG No data
1091998212_1091998215 -9 Left 1091998212 12:5011835-5011857 CCCCTATTTTCTAGATGGAGAAG No data
Right 1091998215 12:5011849-5011871 ATGGAGAAGCAGAATCAAAGAGG No data
1091998213_1091998215 -10 Left 1091998213 12:5011836-5011858 CCCTATTTTCTAGATGGAGAAGC No data
Right 1091998215 12:5011849-5011871 ATGGAGAAGCAGAATCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1091998215 Original CRISPR ATGGAGAAGCAGAATCAAAG AGG Intergenic
No off target data available for this crispr