ID: 1092002732

View in Genome Browser
Species Human (GRCh38)
Location 12:5045024-5045046
Sequence GCGCCCGCCCCTGGGGCCAA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092002720_1092002732 1 Left 1092002720 12:5045000-5045022 CCTCCGGCGCCCCACCAGCCTCC 0: 1
1: 0
2: 6
3: 72
4: 798
Right 1092002732 12:5045024-5045046 GCGCCCGCCCCTGGGGCCAACGG 0: 1
1: 0
2: 0
3: 12
4: 136
1092002724_1092002732 -10 Left 1092002724 12:5045011-5045033 CCACCAGCCTCCCGCGCCCGCCC 0: 1
1: 1
2: 13
3: 142
4: 1012
Right 1092002732 12:5045024-5045046 GCGCCCGCCCCTGGGGCCAACGG 0: 1
1: 0
2: 0
3: 12
4: 136
1092002723_1092002732 -9 Left 1092002723 12:5045010-5045032 CCCACCAGCCTCCCGCGCCCGCC 0: 1
1: 0
2: 2
3: 41
4: 389
Right 1092002732 12:5045024-5045046 GCGCCCGCCCCTGGGGCCAACGG 0: 1
1: 0
2: 0
3: 12
4: 136
1092002717_1092002732 8 Left 1092002717 12:5044993-5045015 CCGCCACCCTCCGGCGCCCCACC 0: 1
1: 0
2: 5
3: 63
4: 795
Right 1092002732 12:5045024-5045046 GCGCCCGCCCCTGGGGCCAACGG 0: 1
1: 0
2: 0
3: 12
4: 136
1092002719_1092002732 2 Left 1092002719 12:5044999-5045021 CCCTCCGGCGCCCCACCAGCCTC 0: 1
1: 0
2: 0
3: 34
4: 316
Right 1092002732 12:5045024-5045046 GCGCCCGCCCCTGGGGCCAACGG 0: 1
1: 0
2: 0
3: 12
4: 136
1092002721_1092002732 -2 Left 1092002721 12:5045003-5045025 CCGGCGCCCCACCAGCCTCCCGC 0: 1
1: 1
2: 4
3: 67
4: 693
Right 1092002732 12:5045024-5045046 GCGCCCGCCCCTGGGGCCAACGG 0: 1
1: 0
2: 0
3: 12
4: 136
1092002718_1092002732 5 Left 1092002718 12:5044996-5045018 CCACCCTCCGGCGCCCCACCAGC 0: 1
1: 0
2: 1
3: 34
4: 475
Right 1092002732 12:5045024-5045046 GCGCCCGCCCCTGGGGCCAACGG 0: 1
1: 0
2: 0
3: 12
4: 136
1092002722_1092002732 -8 Left 1092002722 12:5045009-5045031 CCCCACCAGCCTCCCGCGCCCGC 0: 1
1: 0
2: 11
3: 41
4: 469
Right 1092002732 12:5045024-5045046 GCGCCCGCCCCTGGGGCCAACGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092002732 Original CRISPR GCGCCCGCCCCTGGGGCCAA CGG Exonic
900345409 1:2208160-2208182 GCTCCCACCCCTGGGCACAACGG + Intronic
901251671 1:7784180-7784202 GCGCCCCGCCCCAGGGCCAATGG + Intergenic
903628210 1:24745936-24745958 GCGCCCGGCGCTGGGGCCCCGGG - Intronic
904143181 1:28369714-28369736 TCCCCCTCCCCGGGGGCCAAGGG + Intronic
904619067 1:31764506-31764528 GCGCCGGCGCCTGGGGCCCAAGG - Intronic
905018132 1:34791469-34791491 GGACCCGGCCCTGGGGCCCAGGG + Intronic
906044381 1:42817001-42817023 GCAGCCGCTCCTGGGGCCAGGGG + Intronic
906168687 1:43706524-43706546 GCGCCCACCCCTGGAGGCAGTGG - Intronic
907213631 1:52843470-52843492 TCGCCCGGCCCCGGGCCCAAAGG - Intronic
915558476 1:156673296-156673318 GCGCCTGCCCCTGGCGCCCATGG + Intronic
916713464 1:167431884-167431906 GCTCCTGCCCGTGGGGCCAGGGG - Intronic
921067636 1:211633873-211633895 GCCCCTGCCCTTGGAGCCAAGGG + Intergenic
921390537 1:214609086-214609108 GCCCGCGCCCCTGGGCCCCAGGG + Intronic
921418209 1:214915279-214915301 GTGCCCGCAGCTGGGGCCAGGGG + Intergenic
1062973869 10:1669010-1669032 AGGCCAGCCCCAGGGGCCAAGGG - Intronic
1065815566 10:29479738-29479760 GCACCTGCCCCCGGGGCCACAGG - Intronic
1065957369 10:30705465-30705487 GCACCTGCCCCCGGGGCCACAGG + Intergenic
1072151735 10:92689832-92689854 CCGCCGGGCCCTGCGGCCAATGG - Intergenic
1072620209 10:97074721-97074743 CCGCCCGCCCCTGAAGACAAGGG + Intronic
1074527286 10:114273463-114273485 GAGCCCACTCTTGGGGCCAAGGG + Intronic
1075727946 10:124620271-124620293 GCCCCAGCCCCTGGGCCCCACGG + Exonic
1075729882 10:124629882-124629904 GCCCCTGCCCCTGGGGCCAGAGG + Intronic
1076772073 10:132671243-132671265 GTGGCCTCCCCTGGGCCCAAGGG + Intronic
1076999522 11:315731-315753 GCGCCCCACCCTCGGGCCATTGG - Intergenic
1077055068 11:587571-587593 GCGGCTGACCCTGGGGCCACAGG + Intronic
1077319705 11:1935731-1935753 CCGCCCTCCCCTGGGGCCTCTGG - Intronic
1083771597 11:64870735-64870757 TCGGCAGCCCCTGGAGCCAAGGG + Intronic
1084892608 11:72244001-72244023 GCCCCCGCCCCCCGGGCCGATGG - Exonic
1088797135 11:113273660-113273682 GCTCCCGCCGCTGGGGCCAGTGG + Intronic
1091550109 12:1530468-1530490 GAGCCCGCGCCTCGGGCCCAGGG + Intronic
1092002732 12:5045024-5045046 GCGCCCGCCCCTGGGGCCAACGG + Exonic
1092100683 12:5881385-5881407 GCTGCTGCCCCTGGAGCCAAGGG + Intronic
1096233314 12:49909580-49909602 GGGCCCAGCCCTGGGGCCCATGG + Intergenic
1096797240 12:54085579-54085601 GCGTCCCTCCCTGAGGCCAAGGG + Intergenic
1102562950 12:113775845-113775867 GCCCCCATCCCTGAGGCCAAGGG + Intergenic
1103705332 12:122868207-122868229 ACGCCGGCCCCTGGGGCCAGTGG - Intronic
1105040217 12:132955836-132955858 CCCCTCTCCCCTGGGGCCAAGGG + Intronic
1105446347 13:20460970-20460992 GCGCCCTCCCCTGGGCCTCACGG + Intronic
1110630097 13:77697846-77697868 GCGCCGGCTCCTCGGGCCACGGG - Intronic
1113780447 13:112973769-112973791 GCGCCAGCCCCTGGAGCCACGGG - Intronic
1113843760 13:113374587-113374609 GGTCACACCCCTGGGGCCAAGGG + Intergenic
1114219569 14:20684429-20684451 GCACCCGCCCCAGGGGCCGCAGG - Exonic
1117512967 14:56471556-56471578 GAGGCTGCCCCTGGGACCAAGGG - Intergenic
1117803183 14:59465223-59465245 GCGGCCGCCACTGGGCCCCATGG - Exonic
1117813797 14:59576741-59576763 GCGCCCAGCCCTGGGGTCCAGGG + Exonic
1118925525 14:70187776-70187798 GCACCCACCGCTGGGGCCAAGGG - Intronic
1122995822 14:105263416-105263438 GCTGCCGCCCCTGGAGCCACAGG + Intronic
1123732760 15:23160320-23160342 ACGGCGGCCCCTGGTGCCAAGGG + Intergenic
1123750893 15:23357700-23357722 ACGGCGGCCCCTGGTGCCAAGGG + Intronic
1123825507 15:24078380-24078402 GATCCCACGCCTGGGGCCAAGGG + Intergenic
1124283264 15:28381616-28381638 ACGGCGGCCCCTGGTGCCAAGGG + Intronic
1124299435 15:28529997-28530019 ACGGCGGCCCCTGGTGCCAAGGG - Intronic
1126269132 15:46792519-46792541 GAGACCGTCCCTGGGGCCATAGG + Intergenic
1128322485 15:66703229-66703251 CCCCCCACCCCTGGCGCCAAAGG + Exonic
1131111377 15:89767179-89767201 GTACCAGCCCCTGGGGCCAGCGG + Intronic
1132814064 16:1817622-1817644 GCGCTGGCTGCTGGGGCCAAGGG - Intronic
1134097115 16:11425180-11425202 GCGCCTGCTCCTGGGGCCCCCGG - Exonic
1137426441 16:48384965-48384987 GCCCCCGCCCCTGGAGCCCCGGG - Intronic
1140266808 16:73428219-73428241 GCCCCCGACCCTGGGGTCACTGG - Intergenic
1141168885 16:81678646-81678668 GTGCCCGCCCCCGGGGCCGGTGG + Intronic
1142379004 16:89721374-89721396 GTGCCCGCCTCTGTCGCCAATGG - Intronic
1143783265 17:9240315-9240337 GCGCCCGCCCCCGGGCCCCAGGG - Exonic
1143958843 17:10697642-10697664 GCGCCGGCCCCTGGGCTGAAAGG - Exonic
1147690603 17:42312523-42312545 GCGCGCGTCCCTGAGCCCAAGGG - Intergenic
1148559234 17:48596644-48596666 TCGCCGGCCGCTGGGCCCAAAGG + Exonic
1148629036 17:49092494-49092516 GTGCACACCCCTGGGCCCAAGGG - Intergenic
1150327706 17:64269965-64269987 GGACCCGCCCCTGGGGTAAAGGG + Intergenic
1152228610 17:79103807-79103829 GGGCCCGGACCTGGGGCCCAGGG + Intronic
1152246342 17:79186606-79186628 GCCCCCGCTCCTGGGGCGGAGGG + Intronic
1152247540 17:79192979-79193001 GTGCCAGCCCCTGGTGCCCAGGG + Intronic
1152917904 17:83051570-83051592 GCGCTCGCCCGCGGGGCCTAAGG + Intronic
1153880409 18:9417408-9417430 CCGGCCACCCCTGGGGCCAGTGG + Intergenic
1154940791 18:21111374-21111396 GCGGCCGCCGCTCGGGCCACGGG + Exonic
1157136757 18:45063710-45063732 GCGTCTGCACCTGGGGCCTAGGG + Exonic
1157941740 18:51936137-51936159 GCTACCACCCCTAGGGCCAAGGG - Intergenic
1160404746 18:78637882-78637904 GCGCGGGCCCCAGGCGCCAAGGG - Intergenic
1160837942 19:1133279-1133301 GGGCCCGGCCCTGTGGCCAGGGG + Intronic
1161681236 19:5680869-5680891 GCGCCCGCGCGGGGGACCAAGGG + Exonic
1165080119 19:33302112-33302134 GCCGCCGCCCGTGGGGCCCACGG + Exonic
1166106373 19:40600098-40600120 GCGGCGGCCCCGGGGGCCAGGGG + Exonic
1166351312 19:42199740-42199762 GCGCCAGCGCCTGGGGCCGCCGG + Exonic
1168247049 19:55117610-55117632 CCGCCCGCCCCGGGGGCCGCCGG + Intergenic
926172360 2:10560418-10560440 CTGCCAGCCCCAGGGGCCAATGG + Intergenic
926202665 2:10812799-10812821 GCGGCCGCCCCTCGGACCACCGG - Intronic
929778393 2:44942450-44942472 TCGCACGCCCCGGGGGCCACGGG - Exonic
932591694 2:73071423-73071445 GCGCCCGCCCCGTTGACCAATGG + Intronic
933858382 2:86441227-86441249 GCCCTCGCCCGGGGGGCCAATGG + Intronic
1169406147 20:5322856-5322878 ACACTTGCCCCTGGGGCCAAGGG + Intergenic
1171417440 20:24992640-24992662 GCGCCGGCCCCTGCGGCCGCAGG - Exonic
1172039085 20:32031265-32031287 GCTCCCGCCCCTGGAGCCCCGGG - Exonic
1173246407 20:41340740-41340762 GCCCCCGCCTCCGAGGCCAAAGG + Intergenic
1173813872 20:45972433-45972455 GCGCCCAACCCTGCGGCCTAGGG - Intergenic
1174436520 20:50510746-50510768 ACGCCCGCCCCGGGGACAAAGGG - Intronic
1176110677 20:63409408-63409430 GCCCCCGTCCCTGAGGGCAAAGG - Intronic
1180132419 21:45835198-45835220 GGCCCCGCCCCCGGGGCCCAGGG - Intronic
1180177606 21:46098128-46098150 GCGCCCGCGCCTCGGGCCGTCGG + Exonic
1180850823 22:19019220-19019242 GTCCCGGCCCCGGGGGCCAAGGG - Intergenic
1181267986 22:21642302-21642324 GCTCCAGCCCCTCGGGCCCAGGG - Exonic
1181666045 22:24398136-24398158 GAGGCCTCTCCTGGGGCCAAGGG + Intronic
1183050622 22:35257830-35257852 GCGGCCGCCCCGGGGGCCTGCGG + Intronic
1184490529 22:44805994-44806016 GAGCCCAGCGCTGGGGCCAAAGG + Intronic
1185009455 22:48305097-48305119 GCGCCCACTGCTGGGGCCAGGGG + Intergenic
1185291950 22:50031656-50031678 ACGCCCGCCCCTGGGGACTTTGG - Intronic
949515683 3:4804889-4804911 TCCCCCGCACCTGTGGCCAAGGG + Intronic
949829236 3:8196716-8196738 GTGCCCTCCCCTCTGGCCAAAGG + Intergenic
951543765 3:23806423-23806445 ACCCCCGCCCCTGGGGAAAACGG - Intronic
955484108 3:59418210-59418232 GCACCAGTCCCTGGGGCCACTGG - Intergenic
956688704 3:71856495-71856517 AGGCCCACCCCTGGAGCCAAAGG + Intergenic
961820348 3:129572698-129572720 GCCCCCGGCCTTGGGGCCCATGG + Exonic
968373574 4:18046-18068 ACCCCCACCCCTGGAGCCAATGG - Intergenic
968492242 4:896178-896200 CCTCCCGCCCCTGGGCTCAAGGG - Intronic
968517734 4:1021931-1021953 GAGCCAGCCTCTGGGGCCACGGG + Intronic
969633780 4:8353506-8353528 GAGCCAGTCCTTGGGGCCAAGGG + Intergenic
973907590 4:55546752-55546774 GCGCCCGCCCGGTGGGCCCAGGG - Intronic
978384712 4:108168005-108168027 GCGCCCGCCCCCGAGGCCGAAGG + Exonic
985786727 5:1899443-1899465 GGGCCTGCTCCTGGGGCCACAGG + Intergenic
985875971 5:2594145-2594167 ACGCACTCCCCTGGGGCCAGTGG + Intergenic
986017117 5:3767069-3767091 GCGCCTGCCTCTGGGGCCTTGGG + Intergenic
991371765 5:65926259-65926281 CCGCCCGGCTCTGGGGGCAACGG + Intergenic
993194462 5:84722959-84722981 GGGCCTGCCTCTGGGGCCATAGG - Intergenic
997969204 5:138386418-138386440 CCACCCACCTCTGGGGCCAAAGG - Exonic
1001064927 5:168529141-168529163 GCCCCCGTCCCTGTGGCCCAGGG + Exonic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1002487732 5:179550923-179550945 GCGCCCGCGCCGGCGGCCAGCGG - Intronic
1006421253 6:33935533-33935555 GCTCCCGCCCCTGCAGCCACTGG - Intergenic
1006788821 6:36685641-36685663 ACACCCTTCCCTGGGGCCAATGG - Intronic
1013069486 6:106715805-106715827 CGGCCCTCCCCTGGGGCCAGCGG - Intergenic
1013619478 6:111873557-111873579 GCCCACGCCCCAGGCGCCAATGG - Intergenic
1026923643 7:74174192-74174214 GCGCCCGGCCCTGGGCCCACCGG - Intergenic
1029438018 7:100573443-100573465 GCACCCTCCCCTGGAGCCCAAGG + Exonic
1033662003 7:143408732-143408754 GCGCGCGCCCCCGGGGGCAGCGG + Exonic
1035725860 8:1824369-1824391 GCTCCTGCCCCTGGGGCCAGGGG - Intronic
1036579038 8:10055209-10055231 GCCCCTGCCCCTGGGGACAGCGG - Intronic
1037471598 8:19216160-19216182 GCTCCCCTTCCTGGGGCCAAAGG + Intergenic
1039467875 8:37796988-37797010 GCGCCCGGCCCTCGGGACACTGG - Intronic
1039868853 8:41528950-41528972 GCGCCCGCCACCGCGGCCAAGGG - Intergenic
1041281117 8:56211648-56211670 CCGACCGCCCCTGCGGCCCAGGG + Intergenic
1043233263 8:77829948-77829970 GCCCACACCCCTGGGGCCTAGGG + Intergenic
1048646468 8:136426737-136426759 GTCCCTGCCCTTGGGGCCAATGG - Intergenic
1049427486 8:142543918-142543940 GAGCCTGCTCCTGGGGCCAGGGG + Intronic
1049680204 8:143914785-143914807 GCACCCTCCCCGGAGGCCAAGGG + Intergenic
1056186817 9:84143293-84143315 GCCCCTGCCCCTGGGGACAGAGG + Intergenic
1061280893 9:129597278-129597300 ACGCCCTCCCCAGGGCCCAAGGG - Intergenic
1061727554 9:132589838-132589860 GCACCCGCTCCTGGGGAGAAAGG - Exonic
1062428008 9:136514898-136514920 GCCCCTGCCCCTGGGGCCCCTGG - Intronic
1062453193 9:136624028-136624050 GCCCCTGCCCCTGGGCCCAGAGG - Intergenic
1198270441 X:135051735-135051757 GCACCCGCCCCCAGGCCCAAGGG + Exonic
1200114461 X:153764140-153764162 CCGCCCGCCCCTTTGCCCAATGG - Intergenic
1201900491 Y:19042965-19042987 ACGCCCAACCCTGGGGCCACCGG - Intergenic