ID: 1092003650

View in Genome Browser
Species Human (GRCh38)
Location 12:5050988-5051010
Sequence GCCAATCCTGCCTTAATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092003650_1092003652 -1 Left 1092003650 12:5050988-5051010 CCTCCAATTAAGGCAGGATTGGC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1092003652 12:5051010-5051032 CATTGTTTTCCCTGACTCCTAGG 0: 1
1: 0
2: 0
3: 25
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092003650 Original CRISPR GCCAATCCTGCCTTAATTGG AGG (reversed) Intergenic
906192948 1:43910304-43910326 GCCAATCCTGCCTGCACTGAAGG - Intronic
906983329 1:50655465-50655487 GCCAGCCCTCCCATAATTGGTGG + Exonic
1065317834 10:24481690-24481712 GACAAGCCTGCCATAATTTGGGG + Intronic
1065987238 10:30967082-30967104 GCCAATGCTGCCTTAATCTCAGG - Intronic
1066447686 10:35498597-35498619 GACCATCCTGCCTGGATTGGGGG - Intronic
1066623119 10:37379355-37379377 GCCACTCCTGACTCAGTTGGAGG + Intronic
1067940706 10:50653095-50653117 GTCAATCCTGCAGTAATTGCTGG - Intergenic
1071917067 10:90305309-90305331 GCCACTCCTGCCTAAACTGTTGG - Intergenic
1072218023 10:93304278-93304300 GGCACCCCTGCCTTCATTGGTGG - Intergenic
1075726844 10:124615042-124615064 CCCAATCCTGATTTAATGGGCGG - Intronic
1076081530 10:127586001-127586023 ACCAATGCTGCATTAAATGGAGG - Intergenic
1078955933 11:16195064-16195086 GCCAATCCTGCAATACTTGGTGG - Intronic
1083488327 11:62997112-62997134 GCCATTCCTGCCATAATTCTCGG - Intronic
1086253188 11:84842346-84842368 GCACATCATGCATTAATTGGTGG - Intronic
1090210674 11:124919372-124919394 GCCAAATCTGCCTTAAATTGGGG - Exonic
1092003650 12:5050988-5051010 GCCAATCCTGCCTTAATTGGAGG - Intergenic
1099315935 12:81082365-81082387 GGTAATCCAGCCTTTATTGGGGG + Intronic
1099381505 12:81958756-81958778 GCCAATACTTCCTAAATTGGTGG - Intergenic
1101842715 12:108339691-108339713 GCTATTCCTGCCCTAATTCGTGG + Intergenic
1101938832 12:109083766-109083788 GACAATCCTGACCTAACTGGGGG - Intronic
1102644970 12:114397909-114397931 CTCAATCCTGCCTTAATTTTGGG - Intronic
1106833592 13:33611115-33611137 GGCTTTCCTGCCTTAATTCGGGG + Intergenic
1107302621 13:38981373-38981395 GCCAATCTTGCCTTGAGTGTTGG - Intronic
1107937258 13:45355530-45355552 CTCATTCCTGCCTTAATGGGAGG + Intergenic
1108455138 13:50605531-50605553 GGCAATTCTTCATTAATTGGAGG - Intronic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1120933110 14:89868087-89868109 ACCAATCCATTCTTAATTGGGGG + Intronic
1125996688 15:44168079-44168101 ACCAATCCTTCATTAAATGGGGG + Intronic
1133328178 16:4955023-4955045 GCCAATGCTGCCTTTTGTGGAGG - Intronic
1136656848 16:31714406-31714428 GCCAATCCTACCTCAACTGAAGG - Intronic
1137747225 16:50831405-50831427 GCCAATCATGCCTTAAGAAGAGG - Intergenic
1138252481 16:55512770-55512792 GCCAAGGCCCCCTTAATTGGTGG - Intronic
1148606085 17:48929954-48929976 TCCAATCGTGGCTAAATTGGAGG - Exonic
1148722874 17:49767225-49767247 GCCAAGGCTTCCTTCATTGGAGG - Intronic
1155408092 18:25512461-25512483 GCCACTCCTGCTTTAATTCCTGG - Intergenic
1162231560 19:9270909-9270931 GCCAAGCCTGCAGTGATTGGAGG - Intergenic
930849885 2:55949040-55949062 AACAAGCCTGCCTTTATTGGTGG - Intergenic
939906429 2:147921531-147921553 GTCAATACTGCCAAAATTGGTGG - Intronic
942320706 2:174733167-174733189 GCTTATCCTGGCTTAACTGGGGG - Intergenic
1173268966 20:41514375-41514397 GCCAAACCTTCCTTACTTGTTGG + Intronic
1184265806 22:43345199-43345221 TCCATTCCTGCCTTGATTTGTGG - Intergenic
955226400 3:57063815-57063837 GCCAAGCCTGCCTGAAATGAGGG + Intronic
956202145 3:66717722-66717744 GCCAACCCTGCCTTCTTTCGGGG + Intergenic
956282921 3:67577691-67577713 GCCATTCCTGCCCTTATTTGAGG - Intronic
961720868 3:128895243-128895265 GCCAATGAAGCCTTAATGGGAGG + Intronic
968274083 3:197426491-197426513 GCCAGTTCTGCCTTAGGTGGGGG - Intergenic
968515263 4:1012960-1012982 GCCCATCCTGCCTTCCGTGGGGG - Intronic
969923015 4:10558684-10558706 ACCAATCCTGCCTCTATTGCTGG + Intronic
978711687 4:111790087-111790109 GTATATCCTGCCTTGATTGGAGG + Intergenic
979381551 4:120012392-120012414 CCCACTTCTGCCCTAATTGGAGG + Intergenic
988754630 5:34233752-34233774 TCCTATACTGTCTTAATTGGAGG + Intergenic
993021830 5:82601282-82601304 GCCACTCCTGCTATAATTTGTGG - Intergenic
1001738311 5:174026192-174026214 TCCAGTCTTGCGTTAATTGGTGG - Intergenic
1002479431 5:179490183-179490205 GCCAATCTAGCCTTAAATTGGGG + Intergenic
1012421793 6:99073575-99073597 GCAAATCCTGGCTTCCTTGGTGG + Intergenic
1019183094 6:170204763-170204785 GCCCGGCCTGCCTTAAATGGGGG - Intergenic
1019183103 6:170204785-170204807 GCCCGGCCTGCCTTAAATGGGGG - Intergenic
1019183112 6:170204807-170204829 GCCCAGCCTGCCTTAAATGGGGG - Intergenic
1019964203 7:4485387-4485409 GCCAATCCAGTCTCAATTTGGGG + Intergenic
1026498276 7:70921876-70921898 GCCAATCCTGCTGTGATTTGGGG - Intergenic
1030170984 7:106602618-106602640 TCCATTCCTGCCTTTATTGTGGG - Intergenic
1031920918 7:127600068-127600090 CCCCATCCTGCCTGCATTGGCGG - Intronic
1037648387 8:20814686-20814708 GCCACTCCTGTCTTCAGTGGGGG - Intergenic
1037700740 8:21271831-21271853 GCCAATACTGCCGTCTTTGGAGG + Intergenic
1038130662 8:24727516-24727538 GCAAATCCTCCCTTAACTAGAGG - Intergenic
1038856995 8:31344804-31344826 GCCAATCCTGGCTTCAAGGGTGG - Intergenic
1042783835 8:72523871-72523893 GAAAATCTTGTCTTAATTGGAGG - Intergenic
1044759440 8:95502481-95502503 TCCAATCCCTCCTTAATTGATGG - Intergenic
1045485989 8:102632310-102632332 GGCAAGCCTGCCTGATTTGGGGG - Intergenic
1046586789 8:116157501-116157523 GCATTTCCTACCTTAATTGGTGG - Intergenic
1049479838 8:142816648-142816670 GCCAAAGCTGCCCTAATAGGAGG - Intergenic
1051370976 9:16358783-16358805 GTCCAACCTGCCTTATTTGGTGG - Intergenic
1052481449 9:29032304-29032326 GACATTCCTGCTGTAATTGGAGG + Intergenic
1057334460 9:94144966-94144988 GCCAAACCTGCCCTAAATGTTGG + Intergenic