ID: 1092005460

View in Genome Browser
Species Human (GRCh38)
Location 12:5065890-5065912
Sequence ACTTGATGTTCTGATCACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092005460_1092005461 -8 Left 1092005460 12:5065890-5065912 CCAACGTGATCAGAACATCAAGT No data
Right 1092005461 12:5065905-5065927 CATCAAGTAGTTGATTGTGAAGG No data
1092005460_1092005463 12 Left 1092005460 12:5065890-5065912 CCAACGTGATCAGAACATCAAGT No data
Right 1092005463 12:5065925-5065947 AGGCACAGGTCCCCAAGTGATGG No data
1092005460_1092005462 -2 Left 1092005460 12:5065890-5065912 CCAACGTGATCAGAACATCAAGT No data
Right 1092005462 12:5065911-5065933 GTAGTTGATTGTGAAGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092005460 Original CRISPR ACTTGATGTTCTGATCACGT TGG (reversed) Intergenic
No off target data available for this crispr