ID: 1092005462

View in Genome Browser
Species Human (GRCh38)
Location 12:5065911-5065933
Sequence GTAGTTGATTGTGAAGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092005460_1092005462 -2 Left 1092005460 12:5065890-5065912 CCAACGTGATCAGAACATCAAGT No data
Right 1092005462 12:5065911-5065933 GTAGTTGATTGTGAAGGCACAGG No data
1092005459_1092005462 16 Left 1092005459 12:5065872-5065894 CCAGTCGGTATTTGGAAACCAAC No data
Right 1092005462 12:5065911-5065933 GTAGTTGATTGTGAAGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092005462 Original CRISPR GTAGTTGATTGTGAAGGCAC AGG Intergenic
No off target data available for this crispr