ID: 1092006258

View in Genome Browser
Species Human (GRCh38)
Location 12:5072968-5072990
Sequence CAGTAGGAATAGATTATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092006256_1092006258 -4 Left 1092006256 12:5072949-5072971 CCATTTGGAATAGAGTTTGCAGT No data
Right 1092006258 12:5072968-5072990 CAGTAGGAATAGATTATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092006258 Original CRISPR CAGTAGGAATAGATTATACA TGG Intergenic
No off target data available for this crispr