ID: 1092007495

View in Genome Browser
Species Human (GRCh38)
Location 12:5081578-5081600
Sequence GGTATGCTTTGGCGTGGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092007491_1092007495 12 Left 1092007491 12:5081543-5081565 CCAGGGTTTTATTAATGTTAAAA No data
Right 1092007495 12:5081578-5081600 GGTATGCTTTGGCGTGGAATAGG No data
1092007490_1092007495 26 Left 1092007490 12:5081529-5081551 CCGAACAAGAGAAACCAGGGTTT No data
Right 1092007495 12:5081578-5081600 GGTATGCTTTGGCGTGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092007495 Original CRISPR GGTATGCTTTGGCGTGGAAT AGG Intergenic
No off target data available for this crispr