ID: 1092012365

View in Genome Browser
Species Human (GRCh38)
Location 12:5125182-5125204
Sequence TACTTCAGGATTGCAGTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092012359_1092012365 6 Left 1092012359 12:5125153-5125175 CCCACTGAGAGGGTTCTCCTTCA No data
Right 1092012365 12:5125182-5125204 TACTTCAGGATTGCAGTTAAGGG No data
1092012360_1092012365 5 Left 1092012360 12:5125154-5125176 CCACTGAGAGGGTTCTCCTTCAC No data
Right 1092012365 12:5125182-5125204 TACTTCAGGATTGCAGTTAAGGG No data
1092012356_1092012365 28 Left 1092012356 12:5125131-5125153 CCTGATGCACTGTGAAGTTCTGC No data
Right 1092012365 12:5125182-5125204 TACTTCAGGATTGCAGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092012365 Original CRISPR TACTTCAGGATTGCAGTTAA GGG Intergenic
No off target data available for this crispr