ID: 1092014619

View in Genome Browser
Species Human (GRCh38)
Location 12:5148297-5148319
Sequence GAGTGACATGTGGGCATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092014619_1092014624 26 Left 1092014619 12:5148297-5148319 CCAGGGATGCCCACATGTCACTC No data
Right 1092014624 12:5148346-5148368 GAATGTCTAATCAGTTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092014619 Original CRISPR GAGTGACATGTGGGCATCCC TGG (reversed) Intergenic
No off target data available for this crispr