ID: 1092014624

View in Genome Browser
Species Human (GRCh38)
Location 12:5148346-5148368
Sequence GAATGTCTAATCAGTTACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092014623_1092014624 3 Left 1092014623 12:5148320-5148342 CCAAATCTGAACACAAGATAATG No data
Right 1092014624 12:5148346-5148368 GAATGTCTAATCAGTTACTGAGG No data
1092014622_1092014624 4 Left 1092014622 12:5148319-5148341 CCCAAATCTGAACACAAGATAAT No data
Right 1092014624 12:5148346-5148368 GAATGTCTAATCAGTTACTGAGG No data
1092014619_1092014624 26 Left 1092014619 12:5148297-5148319 CCAGGGATGCCCACATGTCACTC No data
Right 1092014624 12:5148346-5148368 GAATGTCTAATCAGTTACTGAGG No data
1092014620_1092014624 17 Left 1092014620 12:5148306-5148328 CCCACATGTCACTCCCAAATCTG No data
Right 1092014624 12:5148346-5148368 GAATGTCTAATCAGTTACTGAGG No data
1092014621_1092014624 16 Left 1092014621 12:5148307-5148329 CCACATGTCACTCCCAAATCTGA No data
Right 1092014624 12:5148346-5148368 GAATGTCTAATCAGTTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092014624 Original CRISPR GAATGTCTAATCAGTTACTG AGG Intergenic
No off target data available for this crispr