ID: 1092023850

View in Genome Browser
Species Human (GRCh38)
Location 12:5224422-5224444
Sequence ATTTGGGGCTACATGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092023850_1092023858 2 Left 1092023850 12:5224422-5224444 CCTGTCTCCATGTAGCCCCAAAT No data
Right 1092023858 12:5224447-5224469 TGGATCAGGAAGCAGGAGAATGG No data
1092023850_1092023857 -5 Left 1092023850 12:5224422-5224444 CCTGTCTCCATGTAGCCCCAAAT No data
Right 1092023857 12:5224440-5224462 CAAATATTGGATCAGGAAGCAGG No data
1092023850_1092023859 3 Left 1092023850 12:5224422-5224444 CCTGTCTCCATGTAGCCCCAAAT No data
Right 1092023859 12:5224448-5224470 GGATCAGGAAGCAGGAGAATGGG No data
1092023850_1092023861 20 Left 1092023850 12:5224422-5224444 CCTGTCTCCATGTAGCCCCAAAT No data
Right 1092023861 12:5224465-5224487 AATGGGCTTTGGAGTTAGAAAGG No data
1092023850_1092023860 9 Left 1092023850 12:5224422-5224444 CCTGTCTCCATGTAGCCCCAAAT No data
Right 1092023860 12:5224454-5224476 GGAAGCAGGAGAATGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092023850 Original CRISPR ATTTGGGGCTACATGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr