ID: 1092026415

View in Genome Browser
Species Human (GRCh38)
Location 12:5244634-5244656
Sequence CAGTGTAAACAGCAGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092026415_1092026421 22 Left 1092026415 12:5244634-5244656 CCTTTCTTCTGCTGTTTACACTG No data
Right 1092026421 12:5244679-5244701 CTGATTGCTGCAGTATTTGCAGG No data
1092026415_1092026422 23 Left 1092026415 12:5244634-5244656 CCTTTCTTCTGCTGTTTACACTG No data
Right 1092026422 12:5244680-5244702 TGATTGCTGCAGTATTTGCAGGG No data
1092026415_1092026418 -10 Left 1092026415 12:5244634-5244656 CCTTTCTTCTGCTGTTTACACTG No data
Right 1092026418 12:5244647-5244669 GTTTACACTGGATCAGAAGGTGG No data
1092026415_1092026419 -9 Left 1092026415 12:5244634-5244656 CCTTTCTTCTGCTGTTTACACTG No data
Right 1092026419 12:5244648-5244670 TTTACACTGGATCAGAAGGTGGG No data
1092026415_1092026420 -8 Left 1092026415 12:5244634-5244656 CCTTTCTTCTGCTGTTTACACTG No data
Right 1092026420 12:5244649-5244671 TTACACTGGATCAGAAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092026415 Original CRISPR CAGTGTAAACAGCAGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr