ID: 1092029207

View in Genome Browser
Species Human (GRCh38)
Location 12:5269832-5269854
Sequence TTTGTATTTTCAGTAAACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092029199_1092029207 27 Left 1092029199 12:5269782-5269804 CCTCTTAAGTAGCTGGAATTTCA No data
Right 1092029207 12:5269832-5269854 TTTGTATTTTCAGTAAACCCGGG No data
1092029203_1092029207 -4 Left 1092029203 12:5269813-5269835 CCACCATACCGGGCTAATATTTG No data
Right 1092029207 12:5269832-5269854 TTTGTATTTTCAGTAAACCCGGG No data
1092029204_1092029207 -7 Left 1092029204 12:5269816-5269838 CCATACCGGGCTAATATTTGTAT No data
Right 1092029207 12:5269832-5269854 TTTGTATTTTCAGTAAACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092029207 Original CRISPR TTTGTATTTTCAGTAAACCC GGG Intergenic
No off target data available for this crispr