ID: 1092029716

View in Genome Browser
Species Human (GRCh38)
Location 12:5274191-5274213
Sequence AGGGGGAAGCGACTTGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092029706_1092029716 11 Left 1092029706 12:5274157-5274179 CCTCCTTGTTGCAGAAGAAGAGA No data
Right 1092029716 12:5274191-5274213 AGGGGGAAGCGACTTGCCCAGGG No data
1092029707_1092029716 8 Left 1092029707 12:5274160-5274182 CCTTGTTGCAGAAGAAGAGATGG No data
Right 1092029716 12:5274191-5274213 AGGGGGAAGCGACTTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092029716 Original CRISPR AGGGGGAAGCGACTTGCCCA GGG Intergenic
No off target data available for this crispr