ID: 1092035419

View in Genome Browser
Species Human (GRCh38)
Location 12:5330270-5330292
Sequence GTGAAAAAGACCACAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092035419_1092035420 0 Left 1092035419 12:5330270-5330292 CCTTCAGCTGTGGTCTTTTTCAC No data
Right 1092035420 12:5330293-5330315 ACACAACTGAATTCTCACAAAGG No data
1092035419_1092035421 1 Left 1092035419 12:5330270-5330292 CCTTCAGCTGTGGTCTTTTTCAC No data
Right 1092035421 12:5330294-5330316 CACAACTGAATTCTCACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092035419 Original CRISPR GTGAAAAAGACCACAGCTGA AGG (reversed) Intergenic
No off target data available for this crispr