ID: 1092035446

View in Genome Browser
Species Human (GRCh38)
Location 12:5330623-5330645
Sequence TGTTCAATGCTGTAAGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092035442_1092035446 -9 Left 1092035442 12:5330609-5330631 CCCAGACTCACATGTGTTCAATG No data
Right 1092035446 12:5330623-5330645 TGTTCAATGCTGTAAGGGTGAGG No data
1092035443_1092035446 -10 Left 1092035443 12:5330610-5330632 CCAGACTCACATGTGTTCAATGC No data
Right 1092035446 12:5330623-5330645 TGTTCAATGCTGTAAGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092035446 Original CRISPR TGTTCAATGCTGTAAGGGTG AGG Intergenic
No off target data available for this crispr