ID: 1092038394

View in Genome Browser
Species Human (GRCh38)
Location 12:5361790-5361812
Sequence CTATCATTTTCAGAAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092038380_1092038394 30 Left 1092038380 12:5361737-5361759 CCCAGGGTGGCCAACCACACCCC No data
Right 1092038394 12:5361790-5361812 CTATCATTTTCAGAAGGTGCTGG No data
1092038384_1092038394 16 Left 1092038384 12:5361751-5361773 CCACACCCCTCCCCAGCTGGTCA No data
Right 1092038394 12:5361790-5361812 CTATCATTTTCAGAAGGTGCTGG No data
1092038385_1092038394 11 Left 1092038385 12:5361756-5361778 CCCCTCCCCAGCTGGTCACGATT No data
Right 1092038394 12:5361790-5361812 CTATCATTTTCAGAAGGTGCTGG No data
1092038386_1092038394 10 Left 1092038386 12:5361757-5361779 CCCTCCCCAGCTGGTCACGATTT No data
Right 1092038394 12:5361790-5361812 CTATCATTTTCAGAAGGTGCTGG No data
1092038381_1092038394 29 Left 1092038381 12:5361738-5361760 CCAGGGTGGCCAACCACACCCCT No data
Right 1092038394 12:5361790-5361812 CTATCATTTTCAGAAGGTGCTGG No data
1092038389_1092038394 5 Left 1092038389 12:5361762-5361784 CCCAGCTGGTCACGATTTCTCAG No data
Right 1092038394 12:5361790-5361812 CTATCATTTTCAGAAGGTGCTGG No data
1092038388_1092038394 6 Left 1092038388 12:5361761-5361783 CCCCAGCTGGTCACGATTTCTCA No data
Right 1092038394 12:5361790-5361812 CTATCATTTTCAGAAGGTGCTGG No data
1092038387_1092038394 9 Left 1092038387 12:5361758-5361780 CCTCCCCAGCTGGTCACGATTTC No data
Right 1092038394 12:5361790-5361812 CTATCATTTTCAGAAGGTGCTGG No data
1092038390_1092038394 4 Left 1092038390 12:5361763-5361785 CCAGCTGGTCACGATTTCTCAGC No data
Right 1092038394 12:5361790-5361812 CTATCATTTTCAGAAGGTGCTGG No data
1092038382_1092038394 20 Left 1092038382 12:5361747-5361769 CCAACCACACCCCTCCCCAGCTG No data
Right 1092038394 12:5361790-5361812 CTATCATTTTCAGAAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092038394 Original CRISPR CTATCATTTTCAGAAGGTGC TGG Intergenic
No off target data available for this crispr