ID: 1092038678

View in Genome Browser
Species Human (GRCh38)
Location 12:5363951-5363973
Sequence ATGTGATAGTGACTTGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092038678_1092038680 -4 Left 1092038678 12:5363951-5363973 CCACAGCCAAGTCACTATCACAT No data
Right 1092038680 12:5363970-5363992 ACATTCTGAGCACTTTTCCCAGG No data
1092038678_1092038686 16 Left 1092038678 12:5363951-5363973 CCACAGCCAAGTCACTATCACAT No data
Right 1092038686 12:5363990-5364012 AGGTAACCTCAGCGGGAGCCGGG No data
1092038678_1092038687 17 Left 1092038678 12:5363951-5363973 CCACAGCCAAGTCACTATCACAT No data
Right 1092038687 12:5363991-5364013 GGTAACCTCAGCGGGAGCCGGGG No data
1092038678_1092038685 15 Left 1092038678 12:5363951-5363973 CCACAGCCAAGTCACTATCACAT No data
Right 1092038685 12:5363989-5364011 CAGGTAACCTCAGCGGGAGCCGG No data
1092038678_1092038681 8 Left 1092038678 12:5363951-5363973 CCACAGCCAAGTCACTATCACAT No data
Right 1092038681 12:5363982-5364004 CTTTTCCCAGGTAACCTCAGCGG No data
1092038678_1092038682 9 Left 1092038678 12:5363951-5363973 CCACAGCCAAGTCACTATCACAT No data
Right 1092038682 12:5363983-5364005 TTTTCCCAGGTAACCTCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092038678 Original CRISPR ATGTGATAGTGACTTGGCTG TGG (reversed) Intergenic