ID: 1092038679

View in Genome Browser
Species Human (GRCh38)
Location 12:5363957-5363979
Sequence CTCAGAATGTGATAGTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092038679_1092038682 3 Left 1092038679 12:5363957-5363979 CCAAGTCACTATCACATTCTGAG No data
Right 1092038682 12:5363983-5364005 TTTTCCCAGGTAACCTCAGCGGG No data
1092038679_1092038680 -10 Left 1092038679 12:5363957-5363979 CCAAGTCACTATCACATTCTGAG No data
Right 1092038680 12:5363970-5363992 ACATTCTGAGCACTTTTCCCAGG No data
1092038679_1092038687 11 Left 1092038679 12:5363957-5363979 CCAAGTCACTATCACATTCTGAG No data
Right 1092038687 12:5363991-5364013 GGTAACCTCAGCGGGAGCCGGGG No data
1092038679_1092038685 9 Left 1092038679 12:5363957-5363979 CCAAGTCACTATCACATTCTGAG No data
Right 1092038685 12:5363989-5364011 CAGGTAACCTCAGCGGGAGCCGG No data
1092038679_1092038681 2 Left 1092038679 12:5363957-5363979 CCAAGTCACTATCACATTCTGAG No data
Right 1092038681 12:5363982-5364004 CTTTTCCCAGGTAACCTCAGCGG No data
1092038679_1092038686 10 Left 1092038679 12:5363957-5363979 CCAAGTCACTATCACATTCTGAG No data
Right 1092038686 12:5363990-5364012 AGGTAACCTCAGCGGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092038679 Original CRISPR CTCAGAATGTGATAGTGACT TGG (reversed) Intergenic
No off target data available for this crispr