ID: 1092038681 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:5363982-5364004 |
Sequence | CTTTTCCCAGGTAACCTCAG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1092038679_1092038681 | 2 | Left | 1092038679 | 12:5363957-5363979 | CCAAGTCACTATCACATTCTGAG | No data | ||
Right | 1092038681 | 12:5363982-5364004 | CTTTTCCCAGGTAACCTCAGCGG | No data | ||||
1092038678_1092038681 | 8 | Left | 1092038678 | 12:5363951-5363973 | CCACAGCCAAGTCACTATCACAT | No data | ||
Right | 1092038681 | 12:5363982-5364004 | CTTTTCCCAGGTAACCTCAGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1092038681 | Original CRISPR | CTTTTCCCAGGTAACCTCAG CGG | Intergenic | ||