ID: 1092038686

View in Genome Browser
Species Human (GRCh38)
Location 12:5363990-5364012
Sequence AGGTAACCTCAGCGGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092038679_1092038686 10 Left 1092038679 12:5363957-5363979 CCAAGTCACTATCACATTCTGAG No data
Right 1092038686 12:5363990-5364012 AGGTAACCTCAGCGGGAGCCGGG No data
1092038678_1092038686 16 Left 1092038678 12:5363951-5363973 CCACAGCCAAGTCACTATCACAT No data
Right 1092038686 12:5363990-5364012 AGGTAACCTCAGCGGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092038686 Original CRISPR AGGTAACCTCAGCGGGAGCC GGG Intergenic