ID: 1092042024

View in Genome Browser
Species Human (GRCh38)
Location 12:5393577-5393599
Sequence GGAACCTCTGGACCACCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092042014_1092042024 18 Left 1092042014 12:5393536-5393558 CCAGCCTCCCTCATCTGCACTTC No data
Right 1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG No data
1092042017_1092042024 10 Left 1092042017 12:5393544-5393566 CCTCATCTGCACTTCCCCAACAC No data
Right 1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG No data
1092042016_1092042024 11 Left 1092042016 12:5393543-5393565 CCCTCATCTGCACTTCCCCAACA No data
Right 1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG No data
1092042019_1092042024 -4 Left 1092042019 12:5393558-5393580 CCCCAACACACACACCACTGGAA No data
Right 1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG No data
1092042020_1092042024 -5 Left 1092042020 12:5393559-5393581 CCCAACACACACACCACTGGAAC No data
Right 1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG No data
1092042021_1092042024 -6 Left 1092042021 12:5393560-5393582 CCAACACACACACCACTGGAACC No data
Right 1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG No data
1092042015_1092042024 14 Left 1092042015 12:5393540-5393562 CCTCCCTCATCTGCACTTCCCCA No data
Right 1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG No data
1092042013_1092042024 19 Left 1092042013 12:5393535-5393557 CCCAGCCTCCCTCATCTGCACTT No data
Right 1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092042024 Original CRISPR GGAACCTCTGGACCACCAGC TGG Intergenic
No off target data available for this crispr