ID: 1092044143

View in Genome Browser
Species Human (GRCh38)
Location 12:5415316-5415338
Sequence TGGGAAGTGGATCCATTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092044143_1092044150 22 Left 1092044143 12:5415316-5415338 CCTTTTAATGGATCCACTTCCCA No data
Right 1092044150 12:5415361-5415383 ATATCAACGTGAGTTTTGGTGGG No data
1092044143_1092044148 18 Left 1092044143 12:5415316-5415338 CCTTTTAATGGATCCACTTCCCA No data
Right 1092044148 12:5415357-5415379 TTAAATATCAACGTGAGTTTTGG No data
1092044143_1092044149 21 Left 1092044143 12:5415316-5415338 CCTTTTAATGGATCCACTTCCCA No data
Right 1092044149 12:5415360-5415382 AATATCAACGTGAGTTTTGGTGG No data
1092044143_1092044145 -8 Left 1092044143 12:5415316-5415338 CCTTTTAATGGATCCACTTCCCA No data
Right 1092044145 12:5415331-5415353 ACTTCCCAATACTATTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092044143 Original CRISPR TGGGAAGTGGATCCATTAAA AGG (reversed) Intergenic
No off target data available for this crispr