ID: 1092044146

View in Genome Browser
Species Human (GRCh38)
Location 12:5415335-5415357
Sequence ATTGCCATTGTAATAGTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1017
Summary {0: 2, 1: 12, 2: 56, 3: 171, 4: 776}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092044146_1092044150 3 Left 1092044146 12:5415335-5415357 CCCAATACTATTACAATGGCAAT 0: 2
1: 12
2: 56
3: 171
4: 776
Right 1092044150 12:5415361-5415383 ATATCAACGTGAGTTTTGGTGGG No data
1092044146_1092044148 -1 Left 1092044146 12:5415335-5415357 CCCAATACTATTACAATGGCAAT 0: 2
1: 12
2: 56
3: 171
4: 776
Right 1092044148 12:5415357-5415379 TTAAATATCAACGTGAGTTTTGG No data
1092044146_1092044149 2 Left 1092044146 12:5415335-5415357 CCCAATACTATTACAATGGCAAT 0: 2
1: 12
2: 56
3: 171
4: 776
Right 1092044149 12:5415360-5415382 AATATCAACGTGAGTTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092044146 Original CRISPR ATTGCCATTGTAATAGTATT GGG (reversed) Intergenic
900731728 1:4266368-4266390 ATTACCATTGTAACAGTACTAGG + Intergenic
901316249 1:8311453-8311475 ATTCCCAATGTGATGGTATTTGG + Intergenic
901751032 1:11408780-11408802 ATTACTATTGTAATTGTTTTGGG + Intergenic
901900492 1:12357703-12357725 TTTGCTATTGTAATAGTATCAGG + Intronic
902982441 1:20134934-20134956 ATTGACATTGTAACAATATTGGG + Intergenic
902998369 1:20245714-20245736 ATTGCCATTTTGAAAGTATTGGG - Intergenic
903050634 1:20598161-20598183 ATTGCCAATGCAACAGTGTTGGG + Intronic
903598036 1:24511594-24511616 GTTACCATTGTAATTGTTTTGGG - Intronic
905701684 1:40021134-40021156 ATTGTTATTATAATAGTATTAGG + Intergenic
906414765 1:45612282-45612304 ATTCCCATAGTAAGAGTGTTTGG + Intronic
906558893 1:46739158-46739180 GTTACCATTGTAATTGTTTTGGG - Intergenic
906591303 1:47026632-47026654 ATTGCCATCTTAAGAATATTAGG + Intronic
906701382 1:47860664-47860686 ATTGCCAGTGTGGCAGTATTGGG + Intronic
907111805 1:51933532-51933554 ATCCCCAATGTAATGGTATTTGG + Intronic
907151003 1:52287488-52287510 ATTGCCATTAGAACAATATTAGG + Intronic
907761191 1:57362511-57362533 ATTGCCAATGTGATGGTATTAGG + Intronic
908176373 1:61559140-61559162 ATCCCCAGTGTGATAGTATTTGG - Intergenic
908231090 1:62105801-62105823 TTTAGCATTGTAAAAGTATTTGG + Intronic
908345297 1:63226376-63226398 ACTCCCAATGTGATAGTATTAGG + Intergenic
908549595 1:65195289-65195311 ATTGCCAATTTAAAGGTATTGGG - Intronic
908560586 1:65302368-65302390 ATTGCCATTCTGACAGTAATAGG + Intronic
909351137 1:74654684-74654706 ATCCCCAATGTGATAGTATTTGG - Intronic
909375336 1:74934925-74934947 ATTGCTAATGTAATGGTATTGGG + Intergenic
909379824 1:74985692-74985714 AATCCCAATGTCATAGTATTTGG + Intergenic
909705816 1:78582609-78582631 ATTCTCAATGTGATAGTATTTGG + Intergenic
909773716 1:79458221-79458243 ATCACCATTGTGATGGTATTAGG + Intergenic
909829509 1:80169430-80169452 ATTCCCAATGTGATAGTATTAGG + Intergenic
910462311 1:87460728-87460750 ATTGCCAGTGAGACAGTATTGGG - Intergenic
910833681 1:91486059-91486081 ATTGCCAATGTGATATTATTAGG - Intergenic
910941796 1:92543695-92543717 GTTGCTATTGTAATTGTTTTTGG - Intronic
910976423 1:92911172-92911194 ATGTCCATTGTAATTGTATGAGG + Intronic
911376012 1:97052762-97052784 ATTACCATTGAAATAGTTTGAGG - Intergenic
911597186 1:99811117-99811139 ACTCCCAATGTGATAGTATTAGG + Intergenic
911713060 1:101097087-101097109 ATTGCCAATGTGATGGTATATGG - Intergenic
911803036 1:102168209-102168231 ATTGCCATTGTGGTGGTGTTAGG + Intergenic
912006402 1:104906612-104906634 ATTGCCATTTTATCAGTATTAGG + Intergenic
912093062 1:106106179-106106201 ATTGCCAATATAATAATAATAGG + Intergenic
912265514 1:108153170-108153192 ATTGACAGTGTAATAGTGTGGGG - Intronic
913127035 1:115801176-115801198 GTTGCTATTGTAATTGTTTTGGG - Intergenic
913144104 1:115972402-115972424 ATTTCCAATGCAACAGTATTGGG - Intergenic
913302596 1:117388005-117388027 ATTCCCAAAGTGATAGTATTTGG - Intronic
913395726 1:118369754-118369776 ATTAACATTTTAATAATATTAGG + Intergenic
913454083 1:119013232-119013254 ATTGCCAATGTAATGGTGTTGGG + Intergenic
913464797 1:119129159-119129181 ATTCCCAATGTAATGGCATTAGG + Intronic
913573994 1:120151053-120151075 ATTGCCAATGTAATAGTGTTGGG - Exonic
913644439 1:120843372-120843394 ATTGCTATTGGAATATTATTTGG + Intergenic
913654914 1:120951420-120951442 ATTGCTACTGGAATATTATTTGG + Intergenic
914082296 1:144420206-144420228 ATTGCTATTGGAATATTATTTGG - Intergenic
914098806 1:144566622-144566644 ATTGCTATTGGAATATTATTTGG + Intergenic
914177200 1:145288705-145288727 ATTGCTATTGGAATATTATTTGG - Intergenic
914229667 1:145754054-145754076 ATTGCCATTGTTATATTAATTGG - Intronic
914295257 1:146315853-146315875 ATTGCCAATGTAATAGTGTTGGG - Intergenic
914300178 1:146371044-146371066 ATTGCTATTGGAATATTATTTGG - Intergenic
914354680 1:146873973-146873995 ATTGCCATTGTGATGGTATTGGG - Intergenic
914531928 1:148530198-148530220 ATTGCTATTGGAATATTATTTGG - Intergenic
914556298 1:148766636-148766658 ATTGCCAATGTAATAGTGTTGGG - Intergenic
914636464 1:149557535-149557557 ATTGCTATTGGAATATTATTTGG + Intergenic
914645109 1:149645609-149645631 ATTGATATTGGAATACTATTTGG + Intergenic
914696902 1:150091719-150091741 ATTTCCATTGTAATTGCTTTAGG - Intronic
914776282 1:150738722-150738744 ATTACTATTGTAATTGTCTTGGG + Intronic
916456956 1:164980847-164980869 ACTCCCAATGTGATAGTATTAGG - Intergenic
916951770 1:169787629-169787651 ATTACCATTGAGATAGTATAGGG - Intronic
917292873 1:173489499-173489521 ATCCCCAGTGTGATAGTATTTGG - Intergenic
917863399 1:179170298-179170320 ATTGCTATTGAAAAAGTAGTAGG - Intronic
917960469 1:180140253-180140275 ATTTCCAATTTAATTGTATTGGG - Intergenic
918631189 1:186720399-186720421 ATTTCCAATGTGATAGTATTTGG + Intergenic
918642006 1:186852729-186852751 ATTGCTAATGTAATGGTATTGGG - Intronic
918664029 1:187126005-187126027 ATTGCCATTGAAATGATGTTGGG + Intergenic
918704560 1:187644254-187644276 ATTGCCATTGGGAAGGTATTAGG - Intergenic
918922057 1:190725268-190725290 ATTACCAATGTAATTGTATTGGG - Intergenic
918985581 1:191621351-191621373 ACTTCCAATGTAATACTATTAGG + Intergenic
919019700 1:192088392-192088414 ATCACCAATGTAATGGTATTTGG + Intergenic
919105585 1:193146654-193146676 TATTCCATTCTAATAGTATTAGG - Intronic
919132468 1:193468623-193468645 ATGTCCAATGTAATAGTATTGGG - Intergenic
919339512 1:196286225-196286247 ATCCCCAAGGTAATAGTATTAGG + Intronic
919365996 1:196661648-196661670 ATTACCAATGTGATAGTATTAGG - Intronic
919417898 1:197334385-197334407 ATCACCAATGCAATAGTATTGGG + Intronic
919773578 1:201178680-201178702 ATTGCCATTGTGGTGGTATTAGG + Intergenic
920461003 1:206140358-206140380 ATTGCAAATGTAATGGTAATGGG + Intergenic
920643786 1:207781064-207781086 ATTGTCAATGTAATGTTATTGGG - Intronic
921126495 1:212182546-212182568 ATCCCCAGTGTGATAGTATTAGG - Intergenic
921206253 1:212851882-212851904 AGTGCCATTCAGATAGTATTAGG + Intergenic
921224406 1:213003624-213003646 ATTACTATTGTAATGGTTTTGGG - Intronic
921287843 1:213624864-213624886 ATCCCCAATGTAATGGTATTTGG - Intergenic
921609812 1:217198162-217198184 GTTGCTATTGTAATTGTTTTGGG - Intergenic
921754567 1:218839530-218839552 GTTGCCAATGTAATGGTGTTGGG - Intergenic
922012581 1:221606116-221606138 GTTACCATTGTAATTGTTTTGGG + Intergenic
922255020 1:223886110-223886132 ACGGCCATTGTAATGGTATTGGG - Intergenic
922995181 1:229951733-229951755 ACTCCCAATGTGATAGTATTTGG - Intergenic
923319477 1:232816420-232816442 ATTGCCATTGGAATGGTATCAGG - Intergenic
924356462 1:243182005-243182027 ATTGCCAGTGTGACAGTGTTGGG + Intronic
1063805820 10:9638963-9638985 ATCTCCATTGTAAGTGTATTAGG - Intergenic
1063981492 10:11455637-11455659 ACTGCCATCTTAACAGTATTGGG - Intronic
1064038694 10:11938681-11938703 TTTGCTATAGTAAAAGTATTAGG + Intronic
1064273058 10:13882234-13882256 ACTGCCATTGTCATAGTTTAGGG - Intronic
1064510297 10:16082661-16082683 ATTACCAATGTAAGTGTATTGGG + Intergenic
1064794098 10:18991666-18991688 AATGCCCTTGTGATAGGATTTGG - Intergenic
1064891299 10:20177184-20177206 ATTACCATTATAATTGTGTTTGG + Intronic
1065064795 10:21950328-21950350 ATTACCATTGTAATTATTTTGGG + Intronic
1065304498 10:24355569-24355591 ATCTCCAATGTGATAGTATTTGG - Intronic
1065554372 10:26900173-26900195 TTTGCTAATGTAATGGTATTGGG - Intergenic
1066578191 10:36849765-36849787 TTTGCTAATGTAATGGTATTGGG + Intergenic
1066593007 10:37016262-37016284 ATTCCTATTGTGATGGTATTTGG - Intergenic
1068121311 10:52784686-52784708 ATTCCCAAGGTGATAGTATTAGG - Intergenic
1068146433 10:53077117-53077139 ATTGCCTTTGTAATTTCATTAGG - Intergenic
1068424797 10:56846154-56846176 ATTGCCATTTTAACAGTATTAGG + Intergenic
1068436341 10:56995908-56995930 ATTGCCATAGTAGAAGTAGTAGG + Intergenic
1068439013 10:57028277-57028299 ATTCCCAATGCAACAGTATTAGG + Intergenic
1068443251 10:57087300-57087322 AGTGCCATTCAGATAGTATTAGG - Intergenic
1069302133 10:66921291-66921313 ATTCCCAATGTGATGGTATTTGG - Intronic
1069921227 10:71816890-71816912 ATTCCCACTGTAATAGCATAGGG - Exonic
1070028944 10:72658184-72658206 CTTCCCATTGTGATGGTATTAGG - Intergenic
1070062737 10:73000814-73000836 ATTGCCAATGTAATGGTTCTGGG - Intergenic
1070688884 10:78510230-78510252 ATCTCCAGTGCAATAGTATTAGG - Intergenic
1070730599 10:78825314-78825336 ATTGCCATTATCATGGTAATGGG + Intergenic
1070848924 10:79546788-79546810 ACTGCCATTTTATTAGGATTTGG + Intergenic
1070924868 10:80213402-80213424 ACTGCCATTTTATTAGGATTTGG - Intergenic
1070969529 10:80552111-80552133 AGTCCCAGTGTAATGGTATTAGG - Intronic
1071029940 10:81165440-81165462 ATTGCCAATATAATGGTATTGGG + Intergenic
1071880339 10:89890231-89890253 ATTCCCAATGTGATGGTATTTGG - Intergenic
1072184800 10:93026695-93026717 GTTACCATTGTAATTGTTTTGGG + Intronic
1072270304 10:93769905-93769927 ATTGCCATTAGAATTGTATCTGG - Intronic
1073505285 10:103981922-103981944 ATTGACATTTTAACAATATTAGG + Intronic
1073932454 10:108591500-108591522 AATGACATTTTAATAGTCTTAGG + Intergenic
1073955352 10:108864467-108864489 ATCACCAATGTGATAGTATTGGG + Intergenic
1073967169 10:109004023-109004045 ACCCCCATTGTAATGGTATTGGG + Intergenic
1074079729 10:110157910-110157932 ATCCCCAATGTGATAGTATTAGG - Intergenic
1074223126 10:111458234-111458256 ATATCCAGTGTAATGGTATTTGG + Intergenic
1074250106 10:111736506-111736528 ACTCCCATTGTGATGGTATTTGG - Intergenic
1074691452 10:116008612-116008634 TTTACTATTGTAATAGTTTTAGG + Intergenic
1076425838 10:130367081-130367103 GTTGCCAATGGGATAGTATTAGG + Intergenic
1076471082 10:130718875-130718897 ATTGCCACTGTAACGGTATTGGG + Intergenic
1076808199 10:132870133-132870155 GTTACCATTGTAATTGTTTTGGG + Intronic
1078388641 11:10915880-10915902 ATTGCAATTGTTATTTTATTTGG - Intergenic
1079343958 11:19635795-19635817 ATTGCCAATGCAATAGTGTTGGG - Intronic
1079497071 11:21056946-21056968 ATTTCCACTGTAAAAATATTTGG + Intronic
1079592463 11:22196403-22196425 ACTGTCATTGTAATGGTATTAGG - Intronic
1079611370 11:22436418-22436440 ATCACCAATGTGATAGTATTAGG - Intergenic
1080231761 11:30024209-30024231 ATTCCCAATGTTATGGTATTTGG + Intergenic
1080352963 11:31406019-31406041 ATTGTCATTGTGACAGTACTAGG - Intronic
1080884773 11:36356682-36356704 GTTACCATTGTAATTGTTTTGGG + Intronic
1080899570 11:36475849-36475871 TTTGCCATTTTAACAGTTTTGGG + Intergenic
1081182071 11:39996175-39996197 ATTGCCATTATGACTGTATTAGG + Intergenic
1083051427 11:59780214-59780236 ATCGCCAATGTGATGGTATTTGG + Intronic
1083689509 11:64398574-64398596 ATTGCCACTGGGATGGTATTGGG + Intergenic
1083708483 11:64532696-64532718 ATTGCCACTGTGATGGTATTGGG - Intergenic
1085063938 11:73474570-73474592 ATTGCCCATGTAATAGTATTGGG - Intronic
1085847268 11:80080396-80080418 ATAGCCATTGTAACAGCATTGGG - Intergenic
1086937522 11:92761371-92761393 ATTTCCAATGCAATAGTATTAGG - Intronic
1086972432 11:93098104-93098126 ATTGCCAATGTAAGGATATTGGG + Intergenic
1087422483 11:97947876-97947898 ATTTCCAATGTGATGGTATTTGG - Intergenic
1087448455 11:98285989-98286011 AGTGCCTTTGTAAAAGTATTAGG + Intergenic
1087907419 11:103714895-103714917 ACTGCCAATGTGATAGTATTAGG + Intergenic
1087929468 11:103960171-103960193 AATACCTTTGTAATTGTATTTGG - Intronic
1087966723 11:104423918-104423940 ACTGCCATGGTAATGATATTAGG + Intergenic
1088059663 11:105631819-105631841 ATTGCCAAAGAAATACTATTAGG + Intronic
1088141634 11:106623963-106623985 TTTGCCATTGTTATAGTTATTGG + Intergenic
1088934638 11:114387348-114387370 ATTGCAAATGTGATAATATTAGG + Intergenic
1089878349 11:121747563-121747585 ATTCCCAGTGCAATAGTATTGGG + Intergenic
1089913080 11:122123213-122123235 ATTGCCATTGCAATGGTGATGGG - Intergenic
1089942480 11:122433311-122433333 ATTCCCAGGGTAATGGTATTTGG + Intergenic
1090302962 11:125662396-125662418 ATTCCCAATGTGATAGTATTGGG - Intronic
1090738065 11:129629709-129629731 GTTACCATTGTAATTGTTTTTGG - Intergenic
1090995088 11:131858812-131858834 ATTGCCAATTTCACAGTATTTGG - Intronic
1091497941 12:988866-988888 ATTCCCAGTGTGATAGTATTGGG - Intronic
1091510177 12:1114965-1114987 ATTGTAATTGTAATAATCTTAGG - Intronic
1091523109 12:1267870-1267892 ATTGCCATTTTGACATTATTTGG + Intronic
1092044146 12:5415335-5415357 ATTGCCATTGTAATAGTATTGGG - Intergenic
1092311133 12:7354874-7354896 ACTGCCAATGTAATGGTATTAGG - Intronic
1092629082 12:10359271-10359293 ATTGCAAATATAATGGTATTGGG + Intergenic
1092829264 12:12427918-12427940 ATCCCCAGTGTAATGGTATTAGG - Intronic
1093041332 12:14383282-14383304 ATTTACATTGGAAAAGTATTTGG + Intronic
1093055654 12:14553512-14553534 ATTTCCATTCTATTAGAATTGGG + Intronic
1093131273 12:15394128-15394150 ATCTCCAATGTAACAGTATTGGG - Intronic
1093288064 12:17290209-17290231 ATTCCCAGTGTGATGGTATTTGG - Intergenic
1093351301 12:18106033-18106055 ATTACCAATCTAATAGCATTGGG + Intronic
1094006689 12:25760819-25760841 ATCCCCAGTGTGATAGTATTGGG - Intergenic
1094664348 12:32503734-32503756 CAAGCCAATGTAATAGTATTGGG + Intronic
1095093365 12:38128131-38128153 ATTGCCATAGTGATATTTTTTGG - Intergenic
1095330271 12:40952506-40952528 TTAGCCATTTTAATAGTAATAGG + Intronic
1095552143 12:43455579-43455601 ATTGCCAGTGTAACAGTATTGGG - Intronic
1096900823 12:54879547-54879569 ATTGCCAGTGCATCAGTATTAGG - Intergenic
1097347529 12:58510771-58510793 ACTCCCATTGTGATAGTGTTTGG + Intergenic
1097523503 12:60700105-60700127 AATCCCAATGCAATAGTATTAGG - Intergenic
1097523544 12:60700709-60700731 AATCCCAATGCAATAGTATTAGG + Intergenic
1097630420 12:62055015-62055037 ATGGTCAATGTGATAGTATTAGG + Intronic
1097764568 12:63510921-63510943 ATAGCCATTCTAAAAGTATGAGG - Intergenic
1098009143 12:66031807-66031829 AATGACATTGTAAGACTATTGGG - Intergenic
1098206218 12:68112994-68113016 ATGCCCAATGTGATAGTATTTGG - Intergenic
1098267518 12:68737766-68737788 ATTGACTATGTAAGAGTATTAGG - Intronic
1098335914 12:69404354-69404376 GTTGCCATTGTGACAGTGTTGGG + Intergenic
1098747848 12:74263517-74263539 ATTACCAATGTTATAGTATTTGG - Intergenic
1099091216 12:78311690-78311712 ATTACCAATGTGATGGTATTAGG + Intergenic
1099441739 12:82707347-82707369 ATGCCCAGTGTAATGGTATTTGG - Intronic
1099879898 12:88455312-88455334 ATTCCCAATATAATGGTATTTGG - Intergenic
1099998326 12:89804560-89804582 GTTGCCAGTGTAACAGTATTGGG + Intergenic
1100150303 12:91728522-91728544 ATTGCCATTTTCAGAGTGTTAGG - Intergenic
1100172704 12:91993670-91993692 ATTCCCAGTGTAATGATATTTGG - Intronic
1101005333 12:100396140-100396162 ATTCCCAATGTGATGGTATTTGG - Intronic
1101853449 12:108422954-108422976 ATTGCCAATGTGATGGTATTGGG - Intergenic
1103220977 12:119244899-119244921 TTTGCCAATGCAATACTATTTGG + Intergenic
1103300986 12:119926579-119926601 ATCCCCAATGTGATAGTATTTGG + Intergenic
1104027207 12:125036716-125036738 ATTCCCAATGTGATGGTATTTGG + Intergenic
1104073178 12:125364598-125364620 ATTACCATTGTAACAATGTTGGG + Intronic
1104371808 12:128230020-128230042 ATTCCCAATGTGATGGTATTTGG - Intergenic
1105489522 13:20874432-20874454 ATTGCCATTGTAACAGTATTGGG + Intronic
1105500129 13:20964649-20964671 ACTGCCATGGTAACAGTTTTAGG + Intergenic
1105925017 13:25000248-25000270 ATTGCCACCTTAATAGTGTTTGG + Intergenic
1106305869 13:28508745-28508767 GTTGCCAATGTGACAGTATTAGG - Intergenic
1106394901 13:29370267-29370289 ATTGCCATTGTAACAGTATTAGG + Intronic
1106628835 13:31448354-31448376 TTTGACATTGTATTGGTATTTGG - Intergenic
1106633404 13:31501319-31501341 ATTCCCAGTTAAATAGTATTGGG + Intergenic
1106861314 13:33911840-33911862 ATTCCCAATATAATGGTATTGGG - Intronic
1107429683 13:40329221-40329243 ATTGACATTCAAATAGCATTTGG - Intergenic
1107496489 13:40930534-40930556 ATTGCCAAAGTAAAGGTATTGGG + Intergenic
1107543766 13:41417616-41417638 ATTGCCAGTGTAATAGCCTTAGG + Intergenic
1107697329 13:43012966-43012988 ATTGCCAATGTAATGGTATTGGG - Intergenic
1107948786 13:45443688-45443710 ATCCCTAATGTAATAGTATTAGG + Intergenic
1108010359 13:46001043-46001065 ATTACCATTGTAATTGTTCTGGG - Intronic
1108323619 13:49309023-49309045 ATAACCATTGGAATTGTATTTGG - Exonic
1108845099 13:54668601-54668623 ATTACTATTGTAATTGTTTTGGG - Intergenic
1109405512 13:61893367-61893389 ATTTCTATTTTGATAGTATTTGG + Intergenic
1109643556 13:65223064-65223086 ATCCCCAATGTGATAGTATTTGG + Intergenic
1109800613 13:67372737-67372759 ATTGCCATTATAACAATAATGGG - Intergenic
1109865160 13:68254560-68254582 ATTGCCATTGTAACAATGCTTGG - Intergenic
1110006139 13:70272671-70272693 ATTCCCAATGCAATGGTATTGGG - Intergenic
1110145128 13:72181207-72181229 ATTGCCAATGTAATAGCATTGGG + Intergenic
1110486470 13:76050571-76050593 ATTGCCAAGGTGATAGCATTAGG - Intergenic
1110588935 13:77231091-77231113 ATTTGCATTGTAAATGTATTTGG + Intronic
1110602678 13:77393999-77394021 ATTGTCATTGTACTGGTTTTTGG + Intergenic
1110801644 13:79703791-79703813 ATTCCCAATGTAATGGTATCTGG - Intergenic
1110911880 13:80975925-80975947 ATTGCCATTGTGATGATAGTGGG - Intergenic
1111088390 13:83407582-83407604 ATTGCCAATGTAATTGTATTGGG + Intergenic
1111384452 13:87505843-87505865 GTTACTATTGTAATAGTTTTGGG - Intergenic
1111811793 13:93100375-93100397 ATTCCCAGTGCAACAGTATTGGG + Intergenic
1111946447 13:94670306-94670328 ATCCCCATTGTGATGGTATTTGG - Intergenic
1111996846 13:95173769-95173791 ATCACCAATGTAATGGTATTAGG + Intronic
1112288312 13:98123441-98123463 ATCCCCAGTGCAATAGTATTTGG - Intergenic
1112543860 13:100344937-100344959 GTTCCCATTGTAATTGTTTTGGG + Intronic
1112698815 13:101980867-101980889 ATCACCAATGTGATAGTATTAGG + Intronic
1113086118 13:106570796-106570818 ATCACCAATGTAATGGTATTAGG - Intergenic
1113391071 13:109897726-109897748 ATTGTCAGTGTAAGAGTATTGGG + Intergenic
1115018998 14:28651947-28651969 ATTAACATTTTAATTGTATTGGG + Intergenic
1115525164 14:34272531-34272553 ATCCCCAGTGTGATAGTATTTGG - Intronic
1115941036 14:38609915-38609937 ATTGCCATTGTAATAATATTAGG - Intergenic
1116071307 14:40049016-40049038 ATTGCCCTTGTAATGGTATCAGG + Intergenic
1116317510 14:43417154-43417176 ATTGCCATGGTTATTGTTTTAGG + Intergenic
1116337665 14:43678371-43678393 ATTTACATTGTATTAATATTAGG + Intergenic
1116549071 14:46211027-46211049 TCTGCCATGGTGATAGTATTAGG - Intergenic
1116609785 14:47053867-47053889 ATTGCCATTAAAACACTATTTGG + Intronic
1116880219 14:50160356-50160378 ATTAGCATTGTTATATTATTAGG - Intronic
1117103942 14:52379893-52379915 ATCTCCAATGTAATAGTATATGG - Intergenic
1117375942 14:55118306-55118328 ATTTCCATTGTGATAATATGAGG + Intergenic
1117575783 14:57095757-57095779 ATTGCCACTGTGACAGTATTGGG - Intergenic
1117748674 14:58898120-58898142 ATTTCCAATGTGATGGTATTTGG - Intergenic
1117932301 14:60855827-60855849 GTTACCATTGTAATTGTTTTAGG + Intronic
1117950014 14:61073402-61073424 ATTGCCAATGTAATGGTATTGGG - Intronic
1118378784 14:65200884-65200906 ATTACCAATGTGATGGTATTAGG + Intergenic
1118996439 14:70840704-70840726 ATTGCCAATGTAATGATATTGGG - Intergenic
1119035439 14:71226557-71226579 ATTCCCAATGTGATAGTATTGGG - Intergenic
1119277293 14:73370106-73370128 ATTGTTATTGTAATGGTAGTGGG + Intronic
1120218034 14:81701811-81701833 ATTGCCATTACAATAGATTTTGG + Intergenic
1120419329 14:84263567-84263589 GTTACCAGTGTAATAGTATTGGG + Intergenic
1120463731 14:84829243-84829265 AATTCCAGTGTGATAGTATTTGG + Intergenic
1120544117 14:85789240-85789262 ATTCCTATTGTAATTGTTTTGGG + Intergenic
1120600838 14:86506208-86506230 ATTGCTAATATAATGGTATTGGG - Intergenic
1120670176 14:87354057-87354079 ATCACCAATGTAATTGTATTGGG + Intergenic
1121006414 14:90493425-90493447 ATCCCCATTGTGATGGTATTAGG + Intergenic
1121427280 14:93861486-93861508 ATTCCCAGTGTAACAGTATGGGG + Intergenic
1121820621 14:96963053-96963075 ATTGCCATTATAATGGTATTAGG + Intergenic
1121942170 14:98081538-98081560 ATTCCCCTTGTAATAACATTGGG - Intergenic
1122471490 14:101970202-101970224 ATTTCCATTGTAACATCATTAGG - Intronic
1123768036 15:23501105-23501127 ATTCCCAATGTTGTAGTATTAGG + Intergenic
1124403291 15:29369756-29369778 ATTGCCAATGCAACAGTGTTTGG + Intronic
1124570253 15:30856462-30856484 ATTCCCAATGTTATAGTATTAGG - Intergenic
1125043532 15:35220714-35220736 ATTACCATTGCAACAGTTTTGGG - Intronic
1125066416 15:35491089-35491111 ATTGCCAATGTAATGATATTGGG - Intronic
1125102659 15:35932869-35932891 ATTCCCAGTGTGATGGTATTTGG - Intergenic
1125109254 15:36011808-36011830 ATTACTATTGTAATTGTTTTGGG - Intergenic
1125307279 15:38333049-38333071 ATTACCAATATGATAGTATTAGG - Intronic
1125326843 15:38544433-38544455 ATTGTCATTGTAACAGTATTAGG + Intronic
1125344041 15:38700846-38700868 ATTGCCGTTGTTACAGTTTTGGG - Intergenic
1126200365 15:45978801-45978823 ATCACCAATGTAATGGTATTAGG - Intergenic
1126272801 15:46842126-46842148 ATTACCAATGTAACAATATTGGG - Intergenic
1126923588 15:53556120-53556142 ATTGCCAGTGTAAAAGTTTAAGG + Intronic
1129120433 15:73393206-73393228 ATCCCCATTGCGATAGTATTAGG - Intergenic
1129895329 15:79101398-79101420 ATTGCCAATGTAATGGTGTTGGG - Intergenic
1130266594 15:82410359-82410381 ATTGCCAAGTTATTAGTATTGGG + Intergenic
1130363680 15:83213321-83213343 ATCGCCAGTGTGATGGTATTTGG + Intergenic
1130505433 15:84536526-84536548 ATTGCCAAGTTATTAGTATTGGG - Intergenic
1130758356 15:86790632-86790654 ATTTCCATTGGAATACTAATAGG + Intronic
1131365139 15:91832750-91832772 GTTGCCAATATGATAGTATTAGG + Intergenic
1132153991 15:99482618-99482640 ATTGCCATTGTGATGGTATTGGG - Intergenic
1132324963 15:100961300-100961322 ATCCCCATTGTAATGGTATTAGG - Intronic
1133753278 16:8741700-8741722 ATATTCATTGTAATAGTATTTGG + Intronic
1134285659 16:12860089-12860111 ATTACAATTGTAACAGTATTAGG + Intergenic
1134311701 16:13081042-13081064 ATTCCCAATGTGATGGTATTTGG - Intronic
1134347815 16:13407466-13407488 ATGGCCAGTGTGATGGTATTTGG - Intergenic
1135062535 16:19283167-19283189 ATTGTCATTGTGATGATATTGGG + Intergenic
1135813428 16:25610408-25610430 AATGCCAATGTGATAGCATTTGG - Intergenic
1135814991 16:25624210-25624232 ATTATCATTTCAATAGTATTTGG - Intergenic
1137283530 16:46998017-46998039 ATCACCAATGCAATAGTATTAGG - Intergenic
1137416156 16:48282594-48282616 ATTGCTATTGTGATTGTTTTGGG + Intronic
1138002103 16:53291883-53291905 ACTGCCATTGTAATCGTTATAGG + Intronic
1138073006 16:54011794-54011816 ATTACTATTGTAATTGTTTTGGG + Intronic
1138917648 16:61486543-61486565 AATGCCAGTGCAATGGTATTAGG + Intergenic
1139329665 16:66177469-66177491 ATCGCCAGTGTGATGGTATTTGG - Intergenic
1139979340 16:70841559-70841581 ATTGCCATTGTGATGGTATTGGG + Intronic
1141014045 16:80431170-80431192 ATCACCAATGTGATAGTATTTGG - Intergenic
1141201663 16:81903087-81903109 ATCCCCAATGTAATGGTATTTGG - Intronic
1143907374 17:10219908-10219930 ATTGCCAGTGTAATGGTATTGGG + Intergenic
1143956318 17:10672638-10672660 TTTGCCACTGCAATATTATTAGG + Exonic
1144048342 17:11473586-11473608 ATTGCCATTGTAACAATATTAGG - Intronic
1144111404 17:12037864-12037886 ATTCCCTTTGTAATGGTATAAGG - Intronic
1144598828 17:16595529-16595551 ATTGCCATTGTGGTGGTATTGGG - Intergenic
1146042987 17:29474650-29474672 ATTACTATTGTAATTGTTTTGGG - Intronic
1147890067 17:43710900-43710922 GTTGCCATTGTGATGGTATTGGG - Intergenic
1148595045 17:48847358-48847380 AATGCCATTGTAAGAGGATCAGG + Intronic
1149085974 17:52716539-52716561 TTTGCCATTGTAACAGTGTTGGG + Intergenic
1149688032 17:58549633-58549655 AATCCCAGTGCAATAGTATTAGG - Intergenic
1149760763 17:59227607-59227629 ATTGCCATTATCATAGTAACTGG - Intronic
1150153975 17:62835192-62835214 ACTCCCAGTGTAATTGTATTTGG + Intergenic
1150191195 17:63241372-63241394 ATTAGCAGTGTAATGGTATTGGG + Intronic
1150889745 17:69134249-69134271 ATTCCCATTGTGATGGTATTAGG + Intronic
1151072596 17:71233117-71233139 ATTGCCAATGTAACAGTATTAGG + Intergenic
1153455391 18:5275960-5275982 ATTGCCAATGTGATGGCATTAGG + Intergenic
1153896322 18:9565200-9565222 ATTACTATTGTAATTGTTTTGGG + Intronic
1154032019 18:10761843-10761865 ATTGCCAGTGTAACATGATTAGG + Intronic
1154047335 18:10918345-10918367 ATAGACATTGCAAGAGTATTAGG - Intronic
1155701345 18:28747908-28747930 ATTGCCAATGTGATGGTATATGG + Intergenic
1155882355 18:31165062-31165084 GTTGCCGTTGTAATGGTGTTAGG - Intergenic
1156256852 18:35406658-35406680 ATTGCCATTTTTACAATATTAGG - Intergenic
1157012505 18:43668103-43668125 ATTACCAATGCAACAGTATTGGG - Intergenic
1157315496 18:46585587-46585609 ATTGCCATCTTAATAATGTTAGG - Intronic
1157340715 18:46775851-46775873 ATTGCCAATGTAATGATATCAGG + Intergenic
1157630091 18:49086606-49086628 ATCTCCAGTGTGATAGTATTTGG + Intronic
1157991851 18:52506090-52506112 ATTCCCATAGGAAAAGTATTAGG + Intronic
1158089089 18:53689677-53689699 ATCCCCATTGTAACAGTGTTGGG - Intergenic
1158259648 18:55592534-55592556 ATTCCCAATGTGCTAGTATTAGG - Intronic
1158858935 18:61573093-61573115 ACTTCCAATGCAATAGTATTAGG + Intergenic
1159003930 18:62996379-62996401 ATCACCAATGTAATGGTATTTGG + Intergenic
1159414609 18:68127790-68127812 ATTCTCATTGCAATAGCATTAGG + Intergenic
1159639082 18:70842308-70842330 ATTGACCTTGTAATGTTATTTGG + Intergenic
1159654731 18:71019602-71019624 ATTGCCATTGTAAAGATATTGGG + Intergenic
1159715054 18:71811356-71811378 ATTACCATTCTAGTATTATTAGG - Intergenic
1160237306 18:77096300-77096322 AATGTCATTTTAATAGTATCTGG + Intronic
1160479218 18:79222780-79222802 ATTACTATTATATTAGTATTTGG + Intronic
1160959157 19:1710425-1710447 ATTGACATTTTAACATTATTTGG - Intergenic
1162867521 19:13560056-13560078 ATTGAAATATTAATAGTATTGGG + Intronic
1164061103 19:21674933-21674955 ATTGCTACTGTAATAATATTTGG + Intergenic
1164065568 19:21712785-21712807 ATTGCTACTGTAATAAGATTTGG - Intergenic
1164131515 19:22366714-22366736 ATTGCTACTGTAATAAGATTTGG - Intergenic
1164168854 19:22706375-22706397 ATTGCTACTGTAATAAGATTTGG + Intergenic
1164209252 19:23083613-23083635 ATAGCCATTCTAATAGCGTTAGG + Intronic
1164222258 19:23205113-23205135 ATTACCACTGTAATAAGATTTGG - Intergenic
1164490195 19:28703914-28703936 ATTACCACTGTAATTGTTTTGGG - Intergenic
1164505153 19:28854148-28854170 ATTGTCATTGTGACAGTATTGGG + Intergenic
1164511080 19:28897708-28897730 ATTGCCAATGTAATGGTCTTGGG - Intergenic
1164546774 19:29172381-29172403 ATTCCCAATGTGATGGTATTTGG + Intergenic
1164909567 19:31994793-31994815 AATCCCATTGTGATGGTATTTGG - Intergenic
1165217643 19:34287873-34287895 ATTCCCATTGTGATGGTATCTGG - Intronic
1165600064 19:37047224-37047246 ATCACCAATGTCATAGTATTAGG + Intronic
1167252715 19:48409238-48409260 ATTGCCATTGTGATGGTATTGGG - Intronic
1167626823 19:50595807-50595829 GTTGCTATTGTAATTGTTTTGGG + Intergenic
1168060344 19:53888612-53888634 ATAACCACAGTAATAGTATTGGG + Intronic
925251615 2:2443761-2443783 TTTGCCATTGTGATGGTATGAGG - Intergenic
925802652 2:7616774-7616796 ATGGCCAGTGTGATAGTAATAGG + Intergenic
926498744 2:13625553-13625575 ATCCACAATGTAATAGTATTTGG + Intergenic
926798347 2:16637298-16637320 ATTCCCAATGTAATGGTATTTGG + Intronic
927389264 2:22574927-22574949 AATGCCATTGGAATTGTGTTGGG + Intergenic
927507765 2:23625753-23625775 ATTACCATTGTGATGGTGTTTGG + Intronic
927602860 2:24459616-24459638 GTTGCCATGGAAATAGTAATGGG + Intergenic
928434074 2:31242466-31242488 ATTACGAATGTAATAGTATATGG - Intronic
928607569 2:32957561-32957583 GTTACCATTGTAATTGTTTTGGG - Intronic
928721149 2:34123136-34123158 ATCCCCAGTGCAATAGTATTTGG - Intergenic
929228181 2:39532055-39532077 ATCACCAATGTGATAGTATTTGG - Intergenic
929725245 2:44418834-44418856 ATTGACATTTTAACAATATTTGG + Intronic
929812092 2:45199384-45199406 ATTGCCAATGTAATGGTATTGGG + Intergenic
930289369 2:49474564-49474586 ATTGCCAGTGTAAGGGTGTTGGG + Intergenic
930315118 2:49787876-49787898 ATTGCTATTGTATAAGTATGAGG + Intergenic
930464354 2:51727403-51727425 CTTGCCATTGTAATAACACTGGG + Intergenic
930516748 2:52417818-52417840 ATTGACATTTTAATATCATTAGG - Intergenic
930866844 2:56130369-56130391 ATTGTCATTGTCATTGTATTCGG + Intergenic
930878459 2:56245704-56245726 GTTGCCAATGTGATGGTATTAGG + Intronic
930912833 2:56650666-56650688 ATTACCAATGTCATGGTATTAGG + Intergenic
931110759 2:59108832-59108854 ATTGCCATTGTAACAGTATTAGG + Intergenic
931152618 2:59591761-59591783 ATTTCCAATGTAATGTTATTGGG + Intergenic
931639124 2:64366079-64366101 ATTGCCATTTTTATATTATTCGG - Intergenic
931674749 2:64683268-64683290 ATCCCCAGTGTGATAGTATTTGG + Intronic
931967945 2:67554115-67554137 ATCCCCAATGTGATAGTATTAGG - Intergenic
932652327 2:73571572-73571594 ATCCCCAATATAATAGTATTAGG - Intronic
933053816 2:77635350-77635372 ATTGCCATCTTAATAATATCTGG + Intergenic
933131604 2:78679153-78679175 ACTTCCAATGCAATAGTATTAGG - Intergenic
933605628 2:84379369-84379391 ATTTCCAGTGTGATAGTATTTGG - Intergenic
933843917 2:86309810-86309832 ATTCCCAATGTGATGGTATTTGG - Intronic
934104388 2:88682391-88682413 TTTTCCTTTGTAATACTATTTGG + Intergenic
934942498 2:98512704-98512726 ATTGTCATTCTAACAGTAGTGGG - Intronic
935063662 2:99629906-99629928 ATCCCCAATGTGATAGTATTAGG - Intronic
935184434 2:100718677-100718699 ATAGCCCTTGTTATAATATTGGG - Intergenic
935741359 2:106151345-106151367 ATTCCCAATGCAACAGTATTGGG + Intronic
935795649 2:106638949-106638971 ATTGTCAATATAACAGTATTTGG - Intergenic
937282201 2:120726287-120726309 ATTACCAATGTGACAGTATTTGG - Intergenic
937487891 2:122334825-122334847 ATACCCAGTGTGATAGTATTTGG + Intergenic
937495986 2:122419804-122419826 ATTCCCAGTGTGATGGTATTGGG + Intergenic
938129630 2:128702447-128702469 ATTGACATCTTAACAGTATTAGG + Intergenic
938586431 2:132695144-132695166 ATCCCCATTGTGATGGTATTTGG - Intronic
938629323 2:133148831-133148853 ATTTCCAATGTGATGGTATTTGG - Intronic
938683851 2:133717936-133717958 ATTCCCAGTGTGATGGTATTAGG - Intergenic
938809175 2:134836371-134836393 ATTGCCAATGTAGCAGCATTGGG + Intergenic
938997859 2:136699667-136699689 ATCCCCAATGTAATAGTATTAGG - Intergenic
939873147 2:147547470-147547492 ATTGCCAATATAATGGTATTGGG - Intergenic
940363493 2:152820438-152820460 ACTCCCACTGTAATGGTATTTGG - Intergenic
940367779 2:152867800-152867822 ATTGTCATGGTGATAGTATTGGG + Intergenic
940372799 2:152921520-152921542 ATCGCCAGTGTGATGGTATTAGG - Intergenic
941497181 2:166220317-166220339 ATTGCAATTGTGACAGAATTGGG + Intronic
941561277 2:167048052-167048074 ATTCCCAATGTGATGGTATTTGG - Intronic
941575428 2:167224211-167224233 TTTGCCTTTGTGATAGTATTGGG - Intronic
942013775 2:171790586-171790608 GTGGCCAGTGTAATAGTAATAGG - Intronic
942525009 2:176843676-176843698 TTTCCCAGTGTGATAGTATTTGG - Intergenic
942638016 2:178029772-178029794 ATTGCCATTGTGATGATATTAGG + Intronic
942888382 2:180956775-180956797 AATCCCAATGTGATAGTATTTGG + Intergenic
942892711 2:181011458-181011480 ACTGCCACTGTGACAGTATTAGG - Intronic
942948025 2:181690674-181690696 AGTGCCATTGTGACAGAATTAGG - Intergenic
943025257 2:182620023-182620045 ACTGCCATTGTAACAATATTGGG - Intergenic
943678471 2:190742112-190742134 ATTGCCATTGTGACAGTATCGGG + Intergenic
943930793 2:193850253-193850275 ATTGTCAATGTGATTGTATTAGG - Intergenic
944127047 2:196306020-196306042 ATCACCAATATAATAGTATTAGG + Intronic
944184542 2:196932515-196932537 ATCCCCAATGCAATAGTATTAGG + Intergenic
944188605 2:196977216-196977238 ATTGCCATTTTAACAGTATTAGG - Intronic
944874708 2:203950470-203950492 ATCCCCAGTGTAATAGAATTGGG - Intronic
945317550 2:208386850-208386872 ATTCCCAGTGTGATAGTATTTGG - Intronic
945330385 2:208532844-208532866 GTTACCATTGTAATTGTTTTGGG + Intronic
945339918 2:208640209-208640231 ATTGCTATTTTAACAGTATTGGG - Intronic
945541698 2:211095796-211095818 ATTACTATTGTAATTGTTTTGGG + Intergenic
945558803 2:211312600-211312622 ATTGTCAATATAATAATATTAGG + Intergenic
945828549 2:214755116-214755138 ATTCCCATTGTAAAACTAATAGG + Intronic
946853211 2:223928070-223928092 ATTACTATTGTAATTGTTTTGGG - Intronic
946909789 2:224448298-224448320 ATTACCAATGTGATGGTATTAGG + Intergenic
946929667 2:224659364-224659386 ATCTCCAATGTAATGGTATTTGG + Intergenic
946978312 2:225177766-225177788 ATTGCCAAAATAATGGTATTGGG - Intergenic
947028492 2:225765473-225765495 GTTCCCAATGTTATAGTATTTGG + Intergenic
947069839 2:226276293-226276315 ATTTCCCATGTGATAGTATTAGG - Intergenic
947574703 2:231263559-231263581 ATTGCCAATGTAGTAGTACAGGG - Intronic
947694076 2:232168144-232168166 ACTTCCATTGTTATATTATTTGG - Intronic
947786734 2:232829309-232829331 GTTGCCATTCTAGTAGTCTTTGG + Intronic
948661833 2:239512056-239512078 ATCGCCAGTGTGATAGTATTTGG + Intergenic
1169362947 20:4966672-4966694 ACTTCCATTATAATGGTATTAGG + Intronic
1169602024 20:7272436-7272458 ATTACTATTGTAATAGTCTGAGG - Intergenic
1169769066 20:9181734-9181756 ATCCCCAGTGTAATGGTATTTGG - Intronic
1169939101 20:10917900-10917922 ATCACCAATGTGATAGTATTTGG + Intergenic
1170155522 20:13265660-13265682 CTTGCAATTGTGATAGTATTTGG + Intronic
1170195293 20:13683104-13683126 ATTGCCAACGCAATGGTATTGGG + Intergenic
1170676307 20:18484383-18484405 ATTTCCAATGTGATGGTATTTGG + Exonic
1170748809 20:19125203-19125225 ATTTCCAGTGTGATCGTATTAGG - Intergenic
1171205488 20:23276066-23276088 ATTACTATTGTAATTGTTTTGGG + Intergenic
1171451434 20:25238655-25238677 ATTGCTGGTGTAATGGTATTGGG + Intergenic
1172130899 20:32654389-32654411 CTTGCCATCTTAATGGTATTGGG - Intergenic
1172634857 20:36403370-36403392 ATTGCCATTGTGACAGTCTTGGG - Intronic
1173310612 20:41893289-41893311 ATTGCCATTGTATTAGTGCCTGG + Intergenic
1173419436 20:42887837-42887859 ATCCCCAATGTAATAGTATTAGG + Intronic
1173574561 20:44103824-44103846 ATTGCCAATGTGACAATATTAGG + Intergenic
1175042281 20:56064802-56064824 AATGCCAATGTGATGGTATTTGG - Intergenic
1177000714 21:15608979-15609001 ATTGCCAATGTAATGGTATTAGG + Intergenic
1177215560 21:18123731-18123753 ATTGCCTATGTAACAGTATTGGG - Intronic
1177369468 21:20182487-20182509 GTTGCCAATGTGATAGTATGAGG - Intergenic
1177556010 21:22689607-22689629 ATTGTCAATGCAACAGTATTGGG + Intergenic
1177843425 21:26259940-26259962 ATGCCCAGTGCAATAGTATTGGG + Intergenic
1177866442 21:26518304-26518326 ATTGGCAATGTAATGGTATTGGG + Intronic
1177923565 21:27185022-27185044 ATACCCAATGTGATAGTATTAGG - Intergenic
1178204169 21:30443861-30443883 ATTCCCAATGCAATGGTATTTGG + Intergenic
1178228316 21:30751067-30751089 ATTGCCATTGTGAAGGTATTGGG + Intergenic
1178746203 21:35252530-35252552 TTTGCTATTGTAAAAATATTTGG - Intronic
1178952723 21:36998430-36998452 ATTTTCAATGTAATGGTATTGGG - Intergenic
1179194678 21:39153981-39154003 ATCCCCAGTGTAACAGTATTAGG + Intergenic
1182057698 22:27372980-27373002 ATTCCCATTGTATTAGTCTATGG - Intergenic
1182449124 22:30407992-30408014 ATTGCCATTCTTATAGTTTTGGG - Intronic
1182920900 22:34077822-34077844 ATCTCCAGTGTAATGGTATTTGG + Intergenic
1183311802 22:37113849-37113871 ATGCCCATTGCACTAGTATTAGG + Intergenic
1184014867 22:41778287-41778309 ACCCCCAATGTAATAGTATTAGG - Intronic
1184446738 22:44552028-44552050 ATTGCTATTGTCATTGTTTTGGG + Intergenic
1184501625 22:44878194-44878216 GTTGCCTGTGTGATAGTATTAGG - Intergenic
1184904458 22:47471337-47471359 GTTGTCAATGTAATAGTATTAGG - Intronic
1185096924 22:48813897-48813919 GTTACCATTGTAATTGTTTTGGG + Intronic
1185303513 22:50098319-50098341 ATTGTCATTTTAATAATATTAGG + Intronic
949494325 3:4617541-4617563 ATTGTCAATGTAATGGTATTGGG - Intronic
950229553 3:11264589-11264611 ATTGCCATTGTGATCATATTGGG - Intergenic
950237540 3:11336626-11336648 GTTGCCATGGTAATGGTATAAGG + Intronic
950361327 3:12451507-12451529 ATTCCCAATGTAGTTGTATTTGG + Intergenic
950918180 3:16666468-16666490 ATAACCAATGTGATAGTATTTGG + Intronic
951028378 3:17853423-17853445 AATGCCATTATCATAATATTTGG - Intronic
951330298 3:21359673-21359695 AGTGCCACAGTAAAAGTATTTGG + Intergenic
951540588 3:23778421-23778443 ATTGCCAATGTAATGGTATCAGG + Intergenic
951678084 3:25264923-25264945 ATTCCCAATGTGATAGTATTTGG + Intronic
951710526 3:25581645-25581667 ATTCCCAATGTGATGGTATTAGG + Intronic
952016567 3:28963744-28963766 ATGCCCAATGTAATGGTATTAGG - Intergenic
952104946 3:30058543-30058565 ATTGACATTTTTATAATATTAGG + Intergenic
952234374 3:31463787-31463809 ATTGCCAATGTAGTGGTGTTGGG + Intergenic
952697462 3:36285190-36285212 ATTGCCAATGTAACAGTGTTGGG + Intergenic
952748243 3:36802403-36802425 ATTCCCCATGTAATAGCATTTGG + Intergenic
952874991 3:37937276-37937298 GTTGCCATTGTAGTGGTGTTGGG + Intronic
953028222 3:39157625-39157647 ATTGCCATTGTGTCAGTACTGGG + Intergenic
953152749 3:40340179-40340201 ATTCCCAATTTGATAGTATTAGG + Intergenic
953168935 3:40489962-40489984 ATCCCCATTGTAACAGTACTGGG + Exonic
953242320 3:41160543-41160565 ATTACCAAGGTAATGGTATTAGG + Intergenic
953367929 3:42362691-42362713 ATTCCCAATGTAATGGTATTAGG - Intergenic
953408583 3:42673634-42673656 GTTGCCTGTGTGATAGTATTAGG - Intergenic
953801746 3:46029760-46029782 ATTGCCGTTTTAACAATATTGGG + Intergenic
954246210 3:49333717-49333739 GTTGCTATTGTAATTGTTTTGGG - Intronic
954522808 3:51244236-51244258 AATGCCATTGGAATTGTGTTAGG + Intronic
954790756 3:53131530-53131552 ATCCCCAGTGTGATAGTATTAGG + Intergenic
955502345 3:59597799-59597821 ATTCCCAATGTGATGGTATTTGG - Intergenic
955647042 3:61150880-61150902 ATGGCCAATTTAATAATATTTGG - Intronic
955678308 3:61472745-61472767 ATTACTATTGTAATTGTTTTGGG - Intergenic
955938302 3:64123704-64123726 ATTACTATTGTAATTGTTTTGGG + Intronic
956075673 3:65502742-65502764 ATTCCTAATGTAATGGTATTTGG - Intronic
956314663 3:67920700-67920722 ATTCTCAATGTAATAGTATTAGG - Intergenic
956395223 3:68818775-68818797 ATTACTATTGTAATTGTTTTGGG - Intronic
956733355 3:72216973-72216995 ATCCCCAGTGTAACAGTATTGGG - Intergenic
956980948 3:74636765-74636787 ACTCCCAGTGTGATAGTATTAGG + Intergenic
957159716 3:76594947-76594969 ATCCCCATTGTTATGGTATTTGG + Intronic
957168437 3:76706308-76706330 ATTTGCATTTTAAAAGTATTTGG + Intronic
957174109 3:76782898-76782920 ATTGCCATTTTGTTAGTTTTGGG + Intronic
957185464 3:76935921-76935943 ATCGCCAATGTGATGGTATTTGG - Intronic
957375345 3:79349355-79349377 ATTGCCATCTTAACAATATTAGG - Intronic
957732417 3:84156840-84156862 ATTGCCATTGTTATGACATTGGG + Intergenic
957854984 3:85863312-85863334 ATTGCCAATGTCATTGCATTGGG + Intronic
957854996 3:85863400-85863422 ACTGCCAATGTAATTGCATTGGG + Intronic
957863737 3:85994821-85994843 GTTTCCATTGTAATTGTTTTGGG - Intronic
957921234 3:86751044-86751066 ATTTTTATTTTAATAGTATTGGG + Intergenic
958150373 3:89685410-89685432 ATCCTCAGTGTAATAGTATTAGG - Intergenic
958744595 3:98116886-98116908 ATTACCATTTTAAAGGTATTTGG + Intergenic
958778195 3:98510518-98510540 ATTGCCATTGTAACACTATTAGG + Intronic
959003206 3:100989011-100989033 GTTGCCAGTGCGATAGTATTAGG + Intronic
959151285 3:102611364-102611386 ATTTCCACTGTAACAGTATTGGG - Intergenic
959211093 3:103382023-103382045 AATGACATTGTAATAGTAGGAGG - Intergenic
959411998 3:106036001-106036023 GTTCCTAATGTAATAGTATTTGG - Intergenic
959435141 3:106305638-106305660 GCCCCCATTGTAATAGTATTTGG - Intergenic
959707212 3:109349170-109349192 ATTACCAATGCAACAGTATTGGG - Intergenic
959873355 3:111353365-111353387 ACTGCCATTGTGATGGTATTTGG + Intronic
960008369 3:112805582-112805604 ACCTCCATTGTGATAGTATTAGG + Intronic
960020890 3:112951897-112951919 ATTGACATCTTAATAATATTGGG - Intronic
960066855 3:113383465-113383487 ATTCCCCATGTGATAGTATTTGG - Intronic
960633846 3:119763277-119763299 ATAGCCATTCTAACAGTATGAGG - Intronic
960849804 3:122041193-122041215 ATTACCAATGTAACAGTGTTGGG + Intergenic
962073422 3:132055515-132055537 ATTACCAATGTAACAGTATTGGG + Intronic
962897600 3:139730269-139730291 ATTGTCAGTGTAACAGTATTGGG + Intergenic
963328305 3:143886438-143886460 ATCCCCATTGTGATGGTATTAGG - Intergenic
964061559 3:152530588-152530610 ATTACTATTGTAATTGTTTTGGG - Intergenic
964152566 3:153545041-153545063 ATGGTCATTTTAATTGTATTAGG + Intergenic
964885579 3:161478465-161478487 ATTCCCAAGGTAATGGTATTAGG - Intergenic
965441486 3:168720621-168720643 ATTGCCAATGTAATCGTATTGGG - Intergenic
965441545 3:168721199-168721221 ATTGCCAATGTAATAGTATTGGG + Intergenic
965864460 3:173188749-173188771 ATTGCCTATGTAATGGTATGGGG + Intergenic
966003854 3:174983719-174983741 ATTACCAAGGTAATGGTATTAGG - Intronic
966083965 3:176043759-176043781 ATAACCAATATAATAGTATTAGG - Intergenic
966196337 3:177317657-177317679 ATTGCCACCGTAACAGTGTTGGG - Intergenic
966242506 3:177770059-177770081 ATTGCCATTGTAATTATGTTGGG - Intergenic
966338979 3:178903666-178903688 ATTGCCATTGTGACAGTATCAGG + Intergenic
966750880 3:183321088-183321110 GTTGCTATTGTAATTGTTTTGGG - Intronic
967476129 3:189921819-189921841 ATTGACATCTTAATAATATTGGG - Intergenic
968535983 4:1129908-1129930 ATTGCTATTTTACCAGTATTCGG + Intergenic
968840035 4:2996590-2996612 ATTGCCACTGTGACAGTATTGGG - Intronic
968857979 4:3142912-3142934 ACTGACATTGTAATAGTTTTTGG + Intronic
969440542 4:7214206-7214228 ATTGGCAATGTAACAGTATTGGG + Intronic
969465969 4:7356618-7356640 ATTCCCAGTGTAACGGTATTTGG - Intronic
970126699 4:12821634-12821656 ATTACAAATGGAATAGTATTAGG + Intergenic
970136350 4:12928875-12928897 ATCTCCATTGTGATGGTATTTGG - Intergenic
970209895 4:13698201-13698223 ATTGCCAACCTGATAGTATTAGG - Intergenic
970282801 4:14476766-14476788 ATTGCCACTGTGTTAGAATTTGG + Intergenic
970285278 4:14506304-14506326 ATAGCCCTTGTAATAAAATTAGG - Intergenic
970326536 4:14930791-14930813 ATTCCCAATGTGATGGTATTTGG + Intergenic
970530552 4:16977941-16977963 ATTGCCAGTGTAATGGTGTTGGG + Intergenic
970568141 4:17352499-17352521 ATTGACAATGTGATGGTATTTGG + Intergenic
970605393 4:17676353-17676375 GTTGCTATTGTAATTGTTTTGGG - Intronic
970700997 4:18738428-18738450 ATTGCCATTGTGAGGCTATTGGG - Intergenic
970810867 4:20092814-20092836 ATTCCCTTTGTGATGGTATTTGG + Intergenic
971209926 4:24606247-24606269 ATTGCCATTGTAACAGTATTTGG - Intergenic
971362840 4:25952934-25952956 ATTCTCAATGTAATGGTATTAGG + Intergenic
971506445 4:27371366-27371388 ATTGCCATTGTGATGGTATTAGG - Intergenic
971546696 4:27895310-27895332 ATTCCCATTGCAGCAGTATTAGG - Intergenic
971568476 4:28177787-28177809 ATCCCCAGTGTGATAGTATTTGG + Intergenic
971614587 4:28771491-28771513 ACTTCCAATGTAATGGTATTAGG - Intergenic
971759626 4:30748624-30748646 ATTGCCATTGTAATAGTATTAGG - Intronic
971803974 4:31330316-31330338 GTTCCCAATGCAATAGTATTAGG - Intergenic
971882543 4:32396673-32396695 ATTGCCATTGTCAGACAATTGGG + Intergenic
971935122 4:33137897-33137919 ATTGTCATTGTAACAGTGTTGGG - Intergenic
971940289 4:33206547-33206569 ATTGGCATTGTGACAGTATCAGG - Intergenic
971961664 4:33495889-33495911 ATTACCAATGTAATGGCATTAGG - Intergenic
972442927 4:39114433-39114455 ATTGCCAATGTAATAGTGTTGGG - Intronic
973097274 4:46217878-46217900 ATTCCCAGTGTGATAGTATTGGG - Intergenic
973233859 4:47874538-47874560 GTTTCCATTGTAATTGTTTTGGG - Intronic
973597876 4:52511291-52511313 ATTGCCATAGGAATAATCTTGGG - Intergenic
973604413 4:52572163-52572185 ATTGCCAATGTAATGTTATTAGG - Intergenic
973653116 4:53017143-53017165 CTTGCCATAGTAATCATATTTGG + Intronic
973735968 4:53872061-53872083 ATTCCCAATGCAACAGTATTGGG + Intronic
973804860 4:54515804-54515826 ATTGGCAATGCAATAGTATTGGG - Intergenic
973869248 4:55148489-55148511 TTTGCCATGGTAAGAGCATTTGG - Intergenic
973911616 4:55587346-55587368 GTTTCCAATGTGATAGTATTAGG - Intronic
974040830 4:56855965-56855987 ATCCCCAATGTAATGGTATTTGG - Intergenic
974115377 4:57572319-57572341 ATCCCCATTGCAATAGTGTTGGG - Intergenic
974115961 4:57579229-57579251 AATCCCAGTGTAATGGTATTAGG - Intergenic
974294737 4:59982521-59982543 ATTGCCAATGTAATGATATTGGG - Intergenic
974847084 4:67364172-67364194 ATTGCAATTGTAGTAGTAACAGG + Intergenic
974859321 4:67500031-67500053 ATTACTATTGTAATTGTTTTGGG - Intronic
974944332 4:68508626-68508648 ATTGCCATTATTATAGAAGTAGG + Intergenic
974954880 4:68625935-68625957 ATTGCCATTATTATAGAAGTAGG + Intronic
974973146 4:68855854-68855876 ATTGCCATTGTAATTTTTTGAGG + Intergenic
975179008 4:71321789-71321811 ATTGCCATCGTGGTAGGATTGGG - Intronic
975956081 4:79839884-79839906 ATTGCCATTTTAATAATATAAGG + Intergenic
976397705 4:84574079-84574101 ATTCCCAGTGTGATGGTATTTGG + Intergenic
976514368 4:85947487-85947509 ATCACCACTGTAATTGTATTAGG - Intronic
976953916 4:90869798-90869820 ATGGACATTTTAACAGTATTGGG + Intronic
977186938 4:93950751-93950773 ATCTCCATTGCAACAGTATTGGG + Intergenic
977356061 4:95948346-95948368 ATTACTATTGTAATTGTTTTGGG - Intergenic
977638771 4:99331331-99331353 CTTGCCATTGTAATAGTATTAGG + Intergenic
977709804 4:100112172-100112194 ACTTCCAAGGTAATAGTATTAGG + Intergenic
977744227 4:100526009-100526031 ACTGCCAGTGTTATAGTGTTAGG - Intronic
978085885 4:104653523-104653545 ATTGCCGGTGTAATGGTATTGGG - Intergenic
978315814 4:107435765-107435787 ATTGGTATTGTGATAGTAATGGG - Intergenic
978622527 4:110647981-110648003 ATTTCCAGGGAAATAGTATTTGG - Intergenic
978691276 4:111514437-111514459 ATTACCATTGCGACAGTATTAGG + Intergenic
979080219 4:116329459-116329481 ATTTGGATTGTAATTGTATTTGG - Intergenic
979094607 4:116531321-116531343 ATTTCTAATGTAACAGTATTGGG - Intergenic
979184994 4:117777269-117777291 ACTGACATTGTAATACAATTAGG - Intergenic
979245354 4:118497600-118497622 ATTGCCAGTGTGACAGTGTTGGG - Intergenic
979601672 4:122592325-122592347 ATTCCCAATGTAACAGTAATGGG - Intergenic
979729466 4:124006503-124006525 GTTACTATTGTAATTGTATTGGG - Intergenic
979983927 4:127292276-127292298 ATCCCCAGTGTAATGGTATTTGG + Intergenic
980078259 4:128317171-128317193 ATTGCCATTGTGATGGTATTGGG + Intergenic
980321375 4:131282748-131282770 GTTGCCAATGTGATAGTATTAGG + Intergenic
980482912 4:133412059-133412081 ACTGCCATTTTAACAGTACTAGG - Intergenic
980546577 4:134271195-134271217 ATTTCTATTGTAATTGTTTTGGG + Intergenic
980571094 4:134621570-134621592 TTTTGCAATGTAATAGTATTAGG + Intergenic
980609349 4:135137121-135137143 AATCCCAGTGTGATAGTATTTGG + Intergenic
980790159 4:137609953-137609975 ATTCCAATAGTAATAGCATTAGG - Intergenic
981134997 4:141200610-141200632 ATTCCCAATGTGATAGTATTAGG - Intronic
981193761 4:141894366-141894388 ATTTTCATTGAAATAGTTTTAGG + Intergenic
981217103 4:142182925-142182947 ATTGCCGTGATCATAGTATTTGG - Intronic
981384280 4:144109472-144109494 ATTGCCATTGTAACAGTGTTGGG + Exonic
981454689 4:144939631-144939653 ATGGTCATTTTAATTGTATTTGG + Intergenic
981526116 4:145708319-145708341 TTTTCCTTTGTAATACTATTTGG - Intronic
981667776 4:147249219-147249241 ATTGTCATTGTGATGGTATTGGG + Intergenic
981732601 4:147915230-147915252 ATTGCCACTGTAAGAGAATGTGG - Intronic
981777672 4:148388722-148388744 ATTACCCTTTTATTAGTATTTGG - Intronic
981798800 4:148631847-148631869 ACTGCCATTGTAACAGTGTTGGG + Intergenic
981806796 4:148725191-148725213 ATGTCCAATGTAATGGTATTTGG - Intergenic
981857465 4:149311423-149311445 ATTGCCAATGTAATTGTATTGGG - Intergenic
981984786 4:150840601-150840623 ATTACTATTGTAATTGTCTTGGG - Intronic
982211585 4:153041086-153041108 ATTACCAATGTAGCAGTATTGGG - Intergenic
982515311 4:156339532-156339554 TTAGCCATTCTAATAGTATGTGG + Intergenic
982806362 4:159769712-159769734 AGTGCCAAGGTAATTGTATTGGG + Intergenic
982825606 4:160000931-160000953 ATCCCCATTGTGATGGTATTTGG - Intergenic
982903110 4:161032100-161032122 GTTGCTATTGTAATTGTTTTGGG - Intergenic
983162135 4:164429651-164429673 ATAACCAATGTAATGGTATTGGG + Intergenic
983788861 4:171769477-171769499 ATTCCCAATGTAATGGTATCAGG - Intergenic
983808285 4:172022451-172022473 ATTGCCACTGGTATAGTTTTTGG - Intronic
983963548 4:173783107-173783129 ATTGCAATTATAATAGTAACTGG - Intergenic
984203851 4:176762231-176762253 ATTGCCAATGTAAGAATATGGGG + Intronic
984275867 4:177608507-177608529 ATTGCCAATGTAACAGTATTGGG + Intergenic
984423949 4:179559521-179559543 ATCTCCATTGTGATGGTATTTGG - Intergenic
984454474 4:179946627-179946649 ACTGCCATTGTAACACTATTGGG - Intergenic
984730338 4:183062557-183062579 ATTGCCATTGTAACAGTGTTGGG + Intergenic
984900626 4:184583095-184583117 ATCACCAATGTCATAGTATTAGG + Intergenic
985007514 4:185548916-185548938 ATTGCCATTGTGACAGTGTTAGG + Intergenic
985318005 4:188679025-188679047 ATTGCCATTGTAATGATATTAGG + Intergenic
986030956 5:3892110-3892132 ATCCCCAGTGGAATAGTATTTGG - Intergenic
986201898 5:5586778-5586800 ATTGCCAGCGTGATGGTATTTGG - Intergenic
986424484 5:7617000-7617022 ATTGCCATTGTAACACTATTAGG + Intronic
986856141 5:11870961-11870983 ATTCCCAGTGTAATGGTATTTGG + Intronic
986861572 5:11932256-11932278 ATCCCCAATGTAATGGTATTTGG + Intergenic
986897529 5:12388094-12388116 TTTGCCTTTGAAATAGTACTGGG + Intergenic
986985704 5:13499156-13499178 ATTGCCATTGTTGCAGTATTAGG + Intergenic
987224671 5:15827712-15827734 ATTGCCATTATAATGGTATAGGG - Intronic
987248257 5:16072367-16072389 ATTCCCAGTGTGATGGTATTTGG + Intronic
987271221 5:16311237-16311259 ATTGGCATTGTAATAGAAGCTGG + Intergenic
987324249 5:16797905-16797927 ATTGCCATTGTAACAGTATTAGG + Intronic
987482709 5:18478479-18478501 GTTGCCATTGTGATGGTATTGGG - Intergenic
987601686 5:20080018-20080040 ATTGCCAATGTGATGTTATTTGG - Intronic
987698372 5:21361722-21361744 ATTGGCAGTGTGATAGTATCTGG - Intergenic
987718200 5:21598356-21598378 ATTCCCAGTGTGATGGTATTTGG - Intergenic
987799662 5:22677547-22677569 ATCCCCATTGTGATAATATTAGG - Intronic
987813623 5:22872065-22872087 ATTGCTATTGTAAAATTATTGGG - Intergenic
988239397 5:28590011-28590033 ATTGCCCTTGTAAGAGTATTAGG - Intergenic
988735271 5:34014158-34014180 ATCCCCAGTGTAATGGTATTTGG - Intronic
988754279 5:34229804-34229826 ATTGGCAGTGTGATAGTATCTGG + Intergenic
988889112 5:35595293-35595315 GTTACCATTGTAATTATATTGGG - Intergenic
988955065 5:36307622-36307644 ATCTCCAATGTGATAGTATTAGG - Intergenic
989381352 5:40812472-40812494 ATCACCAATGTGATAGTATTAGG - Intergenic
989398869 5:40987605-40987627 ATTCCCAATGCAATGGTATTTGG - Intergenic
989503938 5:42203386-42203408 ATCTCTAGTGTAATAGTATTAGG + Intergenic
989952905 5:50322138-50322160 GTTACCATTGTAATTGTTTTGGG + Intergenic
990146099 5:52762002-52762024 ATTTCCATTGTGATGGTATCTGG + Intergenic
990392008 5:55332762-55332784 ATTGCCAAAGTAATGGTATTTGG - Intronic
990523189 5:56599620-56599642 GTTGCCATTGTAATTGTTTTGGG - Intronic
990595708 5:57310470-57310492 ATTACCAATGTAATGGTGTTTGG + Intergenic
990646339 5:57848796-57848818 ATTGCCATGTTGATTGTATTGGG + Intergenic
990702245 5:58486164-58486186 CTTGTCATTGTAATAGTTTATGG + Intergenic
990718752 5:58669102-58669124 ACTCTCAATGTAATAGTATTTGG - Intronic
990880647 5:60533807-60533829 ATTGCTAATGTAATGGTATTGGG + Intergenic
991228613 5:64303113-64303135 ATTACTATTGTAATTGTTTTGGG + Intronic
991277181 5:64863012-64863034 ATTCCCAGTGTGATGGTATTTGG - Intronic
991491454 5:67187786-67187808 ATTGCCATTGTAATACTAAGAGG + Intronic
991742056 5:69690651-69690673 ATTGGCAGTGTGATAGTATCTGG + Intergenic
991755637 5:69864557-69864579 ATTGGCAGTGTGATAGTATCTGG - Intergenic
991793630 5:70270391-70270413 ATTGGCAGTGTGATAGTATCTGG + Intergenic
991821446 5:70565955-70565977 ATTGGCAGTGTGATAGTATCTGG + Intergenic
991834964 5:70739705-70739727 ATTGGCAGTGTGATAGTATCTGG - Intergenic
991886009 5:71269923-71269945 ATTGGCAGTGTGATAGTATCTGG + Intergenic
991965807 5:72089444-72089466 AATGCCATCTTAATATTATTAGG - Intergenic
992007437 5:72491668-72491690 ATGGCAATTATACTAGTATTTGG + Intronic
992560818 5:77951113-77951135 ATTGTCATTGTGATGGTATTGGG + Intergenic
992930256 5:81636004-81636026 ATTACCAATGTGATGGTATTTGG + Intronic
993172681 5:84439410-84439432 GTTACCAATGTAATTGTATTGGG + Intergenic
993284413 5:85973197-85973219 ATCCCCAGTGTGATAGTATTTGG + Intergenic
993811583 5:92485484-92485506 ATTGCCATTTTACCAGTATTGGG - Intergenic
993938436 5:94030691-94030713 ATTGCCAATGTAACAGTATTGGG + Intronic
993938783 5:94033834-94033856 ATTGCCAATGAAATAGTATTGGG + Intronic
994053523 5:95389653-95389675 ATTGCCATTCTAATAGTATTAGG - Intergenic
994282368 5:97921115-97921137 ATTCCCATTGTGATGGAATTTGG + Intergenic
994348127 5:98712115-98712137 ATTATAATTGTAATAGCATTGGG - Intergenic
994913650 5:105945249-105945271 AATTCCAATGTGATAGTATTTGG + Intergenic
995139251 5:108715879-108715901 ACTTCCATTGTAATGGTATTTGG - Intergenic
995284679 5:110374261-110374283 ATTGTCATTGTGAAAATATTTGG + Intronic
995485091 5:112632288-112632310 ACTGCCAATATAACAGTATTGGG - Intergenic
995553834 5:113307242-113307264 ATCGACATTTTAATAATATTAGG + Intronic
995625496 5:114071865-114071887 ATTGCCAATGCAACAGTGTTGGG + Intergenic
996179766 5:120405000-120405022 ATTGCCAGTATGATGGTATTTGG - Intergenic
996289551 5:121835584-121835606 CTTGCCATTGTGACAGTACTGGG + Intergenic
996351950 5:122553737-122553759 GTTGCTATTGTAATTGTTTTGGG + Intergenic
996357748 5:122615558-122615580 ATTGCCATTGCAACAGTATTGGG + Intergenic
996433157 5:123402802-123402824 ATGGCCAATGTGATGGTATTAGG + Intronic
996807455 5:127472731-127472753 ATTACTATTGTAATTGTTTTGGG - Intergenic
996907123 5:128613425-128613447 ATTTCCATTATGATAGTATTAGG - Intronic
996988374 5:129597410-129597432 ATTGCCATTTTAATAATTTCAGG - Intronic
997069194 5:130599463-130599485 GTTTCCAGTGTGATAGTATTTGG - Intergenic
997165029 5:131651649-131651671 ATTCCCAGTGTGACAGTATTTGG - Intronic
997559938 5:134837539-134837561 ATTCCCAATTTGATAGTATTTGG + Intronic
997900987 5:137764169-137764191 AATCCCATTGTGACAGTATTTGG + Intergenic
999430859 5:151524369-151524391 ATCCCCAGTGTAACAGTATTTGG + Intronic
1000333315 5:160223268-160223290 GTTACCATTGTAATTGTTTTGGG + Intronic
1000426483 5:161097003-161097025 ATTACCAATGTGATGGTATTAGG + Intergenic
1000453798 5:161423538-161423560 ATTACTATTGTAATTGTTTTGGG + Intronic
1000456249 5:161453377-161453399 ATTTCCAATGTAATGGTAGTGGG + Intronic
1000518805 5:162274536-162274558 ATTGCCGTTGAAATGGTAGTTGG + Intergenic
1000789477 5:165587674-165587696 AATGCCATTGAAATAATAATTGG + Intergenic
1000873038 5:166601093-166601115 ATTACCATTGTAGTTATATTGGG + Intergenic
1001501872 5:172243346-172243368 ATACCCAATGTGATAGTATTTGG + Intronic
1003275075 6:4643468-4643490 GTTACCATTGTAATTGTTTTGGG - Intergenic
1003718443 6:8673671-8673693 ATTCCTAATGTAATTGTATTTGG + Intergenic
1003751191 6:9058506-9058528 ATTGCCATAGTAATAAGATGAGG + Intergenic
1003839776 6:10107938-10107960 ACTGCCAATGTAATAGTACTGGG - Intronic
1004628739 6:17401137-17401159 ACTGCCATTGTGATGGTATTAGG + Intronic
1004658159 6:17684929-17684951 ATTACTATTGTAATTGTTTTGGG - Intronic
1004699206 6:18063218-18063240 ATTCCTATTGTGATGGTATTAGG + Intergenic
1004996043 6:21194175-21194197 ATTGACAATGTAACAGTGTTGGG - Intronic
1005129723 6:22492264-22492286 ATCACCAGTGTGATAGTATTAGG + Intergenic
1005279266 6:24254502-24254524 ATCTCCATTGTAATCTTATTGGG + Intronic
1005552462 6:26936659-26936681 ATTGGCAGTGTGATAGTATCTGG + Intergenic
1005907236 6:30274112-30274134 ATTGCTATTGTAACATTATTAGG - Intergenic
1005937234 6:30532567-30532589 ATTCCCAATGTGATAGTCTTTGG - Intergenic
1007023610 6:38546997-38547019 GTTACCATTGTAATTGTATCTGG + Intronic
1007184442 6:39956700-39956722 ATTGTCATTGTACTAGTTTGTGG - Intergenic
1007852357 6:44815845-44815867 TTTGCCTTTGAAATAGTAATGGG - Intronic
1007868997 6:45010780-45010802 ATTCCCAGTGTGGTAGTATTTGG - Intronic
1008197869 6:48547324-48547346 ATTCCCAATGTGATAGTGTTGGG + Intergenic
1008559763 6:52712485-52712507 ATAGCCAGAGAAATAGTATTGGG + Intergenic
1008722165 6:54368011-54368033 ACTCCCATTGCAATGGTATTAGG - Intronic
1009331722 6:62430613-62430635 ATTCCCAATGTGATGGTATTTGG - Intergenic
1009456398 6:63861653-63861675 ACTGCCAATGTGATGGTATTTGG + Intronic
1009511857 6:64561805-64561827 ATAGCCAATTTAATAGTTTTGGG - Intronic
1009557067 6:65184443-65184465 ATTGCCATTTTTATAGTATTGGG - Intronic
1009590012 6:65656054-65656076 GTTACCATTGTAATTGTTTTGGG + Intronic
1009896855 6:69762649-69762671 ACTCCCAATGTGATAGTATTTGG + Intronic
1010050046 6:71492980-71493002 ATTACTATTGTAATAGTTTTGGG + Intergenic
1010507639 6:76680084-76680106 ATCACCAATGTGATAGTATTAGG + Intergenic
1010726390 6:79338683-79338705 ATCCCCATTGTGATGGTATTTGG + Intergenic
1010914095 6:81594673-81594695 TCTACCAGTGTAATAGTATTAGG + Intronic
1010923441 6:81713388-81713410 ATTGCCAGTTTAATGGAATTTGG - Intronic
1011043247 6:83054048-83054070 ATTGCCAATGGAGTAGTATATGG - Intronic
1011574561 6:88781603-88781625 ATTTTCATTGTAAGTGTATTTGG - Intronic
1011621325 6:89245566-89245588 ATTCTCAATGTAATGGTATTTGG + Intergenic
1012287686 6:97412921-97412943 GTTGCGATTGTAATTGTTTTGGG - Intergenic
1012297959 6:97547954-97547976 AATTCCAGTGTGATAGTATTAGG - Intergenic
1012681394 6:102186338-102186360 AATACCATTGTTATAGTATAAGG - Intergenic
1012764774 6:103352845-103352867 ATTGCCATTGTAACAGTGTTGGG - Intergenic
1012861896 6:104570259-104570281 ATTGCCATTGTGACAGTATTGGG - Intergenic
1012964518 6:105658591-105658613 ATTGCCAATCTAAGAATATTGGG + Intergenic
1013729762 6:113151291-113151313 ATTACTATTGTAATTGTTTTGGG - Intergenic
1013998163 6:116333503-116333525 ATTGCCAATGTAACGGTATTGGG - Intronic
1014182087 6:118396028-118396050 AGTGCCACTGTAACTGTATTTGG + Intergenic
1014559018 6:122868474-122868496 ATTCCCAATGCAACAGTATTGGG + Intergenic
1014728694 6:125005138-125005160 ATTGCCATTGCAACATTATGAGG - Intronic
1014775184 6:125500612-125500634 ATTCCTATTGTAATTGTTTTGGG - Intergenic
1015093785 6:129389952-129389974 ATTCCCAATGTGATGGTATTTGG - Intronic
1015333561 6:132009148-132009170 ATTGCCAATATAACAGTATTGGG + Intergenic
1015821339 6:137264274-137264296 ATTGCCATTGGGGTAGTACTAGG + Intergenic
1015939720 6:138435919-138435941 ATTACTATTGTAATTGTTTTGGG + Intronic
1016224295 6:141715801-141715823 ATTGCCATAATAATGGCATTGGG + Intergenic
1016387958 6:143547140-143547162 ATTCCCATTATAATCTTATTAGG + Intronic
1016630800 6:146228498-146228520 ATTGCCACTGTAACAGCATTAGG - Intronic
1016653706 6:146493463-146493485 ATGCCCAGTGTAATGGTATTTGG - Intergenic
1016706855 6:147118837-147118859 ATTGCCAGTGTAACAGTGATGGG + Intergenic
1016797442 6:148132987-148133009 ATCCCCAATGTGATAGTATTTGG - Intergenic
1016888557 6:148982481-148982503 GTTGCCAATGTCATAGTATTAGG - Intronic
1017139422 6:151177203-151177225 ATTAACATTGTAATTATATTTGG + Intergenic
1017555573 6:155563180-155563202 ATCGCCAGTGTGGTAGTATTTGG + Intergenic
1017844459 6:158244442-158244464 AGTCCCAATGTGATAGTATTTGG + Intronic
1018076604 6:160221804-160221826 ACTGCTATTGTAATTGTTTTAGG - Intronic
1018494505 6:164336381-164336403 ATTCCCATAGTGATAGTATTAGG + Intergenic
1018546563 6:164942934-164942956 ATCCCCATTGCAATAGTGTTGGG - Intergenic
1019229642 6:170548606-170548628 ATTGCCATTGTGATGGTACTGGG + Intronic
1020467221 7:8494617-8494639 ATTGGCATTGTCAAGGTATTTGG - Intronic
1020817042 7:12918344-12918366 ATTGCCATTGTAGCAGTATTAGG + Intergenic
1020843341 7:13249975-13249997 AATGCCATTGGAATATTTTTAGG + Intergenic
1021092366 7:16498980-16499002 AATGCCTTTAGAATAGTATTGGG + Intronic
1021101907 7:16594033-16594055 ATCCCCATTGTGATGGTATTTGG + Intergenic
1021132812 7:16931615-16931637 ATTACTATTGTAATTGTTTTAGG - Intergenic
1021726597 7:23553102-23553124 AAAGCCATTGTGATAGTATGCGG + Intergenic
1021980766 7:26053199-26053221 ATTGTCATTGTAGTAGTATTGGG + Intergenic
1022061952 7:26806031-26806053 GTTACCATTGTAATTGTTTTGGG + Intronic
1022550452 7:31234406-31234428 GTTGCCATTGTAACAGGTTTGGG + Intergenic
1022829492 7:34051224-34051246 ATCACCAATGTAATGGTATTAGG - Intronic
1022904590 7:34843467-34843489 ATTGTCATTGTAACAGTATTGGG - Intronic
1022925692 7:35054151-35054173 ATTGGCATTGTAATGGAAGTGGG + Intergenic
1023018726 7:35990492-35990514 ATTGCCATCTTAACAATATTCGG - Intergenic
1023325200 7:39047306-39047328 ATTGCCATTTTAACACTATTAGG + Intronic
1023498621 7:40824881-40824903 ATTGCCATTGTGATGGTATTGGG - Intronic
1023624718 7:42104704-42104726 ATCCCCAATGTAATGGTATTTGG + Intronic
1024852598 7:53738251-53738273 ATTACTATTGTAATTGTTTTGGG + Intergenic
1024968440 7:55046795-55046817 ATTGCCATTGTGACAGCATTGGG - Intronic
1025952740 7:66158332-66158354 ATCCCCATTACAATAGTATTGGG + Intergenic
1026965760 7:74438919-74438941 ATCTCCATTGTAGTGGTATTAGG - Intergenic
1027337408 7:77167024-77167046 TTTGCAATTGTAATATTCTTTGG + Intronic
1027808174 7:82856826-82856848 ATTGCCAATGTTATGGTATTGGG + Intronic
1028313347 7:89367546-89367568 ATTGCCATTGTGATATTAAGAGG - Intergenic
1028886259 7:95937764-95937786 ATTGTCATTGTAATAGGAAAAGG - Intronic
1029003471 7:97181993-97182015 ATTCCCAGTGTGATACTATTAGG + Intergenic
1029778392 7:102704093-102704115 TTTGCAATTGTAATATTCTTTGG - Intergenic
1030254485 7:107492994-107493016 ATCCCCAATGTAATAGTGTTGGG + Intronic
1030264993 7:107611185-107611207 ATTACCAATGTGATCGTATTGGG - Intronic
1030435680 7:109516772-109516794 ATTAGCAATGTAATAGTATGAGG - Intergenic
1030445054 7:109638691-109638713 ATTTCCATTGTGATGGTATTGGG - Intergenic
1030584648 7:111402811-111402833 ATTTCCATTGTGAAGGTATTAGG - Intronic
1030901081 7:115124583-115124605 ATCCCCAGTGTGATAGTATTGGG + Intergenic
1031281761 7:119811826-119811848 ATTGCTATCGTAATTGTTTTGGG - Intergenic
1031321300 7:120332131-120332153 AATGCCATTGTAATAGGTATTGG - Intronic
1031448197 7:121881056-121881078 CCTGCCATTGTGATCGTATTTGG + Intronic
1031573941 7:123393100-123393122 ATTTCCATTGTGACAATATTGGG - Intergenic
1031821580 7:126508487-126508509 ATTGCCAAAGTAACAGTATTGGG - Intronic
1031896670 7:127357755-127357777 AATTAAATTGTAATAGTATTAGG - Intronic
1032140670 7:129327125-129327147 ATTCCCAGTGTGATGGTATTAGG + Intronic
1032423039 7:131798544-131798566 ATTGCCATTGTGACAGTATTAGG + Intergenic
1032554053 7:132813030-132813052 ATTGCCATTGTCAAGTTATTTGG + Intronic
1033554928 7:142480972-142480994 TTTGTCAATGTAATGGTATTGGG + Intergenic
1033559535 7:142518502-142518524 TTTGTCATTGTAATGGTATTGGG + Intergenic
1033561041 7:142530876-142530898 ATTACCACTTAAATAGTATTGGG - Intergenic
1034293759 7:149952331-149952353 AATGGCATTGTCATAGTTTTAGG + Intergenic
1034812307 7:154144523-154144545 AATGGCATTGTCATAGTTTTAGG - Intronic
1036412737 8:8517843-8517865 GATGCCATTTTAATAGGATTTGG + Intergenic
1036452215 8:8878767-8878789 ATTAACATTGTATTAGTACTAGG - Intronic
1037009345 8:13821186-13821208 ATGGCCAGTGTAACAGTGTTGGG - Intergenic
1037171112 8:15893438-15893460 ATTGCCAATGTAGCAGTGTTAGG + Intergenic
1037215268 8:16443593-16443615 ATTCCCAGTGCAACAGTATTGGG + Intronic
1037453790 8:19043607-19043629 ATTGCCGATGGAATGGTATTGGG + Intronic
1037867676 8:22459747-22459769 ATCCCCAATGTAATGGTATTAGG + Intronic
1038343074 8:26705319-26705341 ATTGCCATTGTAATAGTTTTAGG + Intergenic
1038348109 8:26750583-26750605 TTTCCCATTGTAAAACTATTTGG - Intronic
1038355747 8:26827776-26827798 ATCACCAATGTAATAGTACTAGG - Intronic
1038657899 8:29470854-29470876 ATTGCCAATGTAATTGTATTGGG - Intergenic
1038754487 8:30327911-30327933 ATTGGCATTGTAATGGTATTGGG - Intergenic
1038759891 8:30376464-30376486 ACCTCCATTGTGATAGTATTAGG - Intergenic
1038854541 8:31317179-31317201 ATCTCCAATGTGATAGTATTAGG + Intergenic
1038936633 8:32259239-32259261 ATTGCCATTGTAATGGTATTAGG + Intronic
1039406081 8:37313805-37313827 ATTGCCATTGTGATGGAATTGGG - Intergenic
1039508594 8:38070839-38070861 ATTGCCAATATAATGGTGTTGGG - Intergenic
1039686476 8:39807508-39807530 AGCCCCATTGTAACAGTATTTGG + Intronic
1041242687 8:55861731-55861753 AATCCCAGTGTAATGGTATTAGG - Intergenic
1041277402 8:56176918-56176940 TTTGCGATTTTAATAGCATTAGG - Intronic
1041476016 8:58266791-58266813 GTTACCATTGTAATTGTTTTGGG - Intergenic
1042000073 8:64112222-64112244 ATCCCCAATGTAATTGTATTTGG + Intergenic
1042299421 8:67260500-67260522 GTTGCTATTGTAATTGTTTTGGG + Intronic
1042353838 8:67804423-67804445 ATCCCCAATGTGATAGTATTCGG - Intergenic
1042441031 8:68826879-68826901 ATTACTATTGTAATTGTTTTAGG - Intergenic
1042473151 8:69214047-69214069 GCTTCCAATGTAATAGTATTTGG + Intergenic
1042634626 8:70860201-70860223 AATCCCAGTGTGATAGTATTTGG + Intergenic
1042745719 8:72103525-72103547 TTTACTATTGTAATAGGATTTGG - Intronic
1042994577 8:74681542-74681564 ATTGCCAATGTAATGGTATTGGG + Intronic
1043281749 8:78476437-78476459 ATCCCCAATGTAATGGTATTTGG - Intergenic
1043374548 8:79633731-79633753 ATTCCCAATGTGATAGTATTTGG - Intronic
1043389303 8:79776728-79776750 ACCCCCAATGTAATAGTATTTGG + Intergenic
1043638730 8:82421416-82421438 TTTGCAATGGTAAAAGTATTTGG - Intergenic
1043651380 8:82596882-82596904 ATTGTCAATGTGATGGTATTTGG - Intergenic
1043862053 8:85330198-85330220 TTTGCCATTGAAATAGAATCTGG - Intronic
1044137081 8:88599571-88599593 ATTGCCATTGTGATGGTATTGGG - Intergenic
1044164532 8:88966051-88966073 ATTGCCATTTTAACAATATTAGG + Intergenic
1044416299 8:91944165-91944187 ATTCCCAATGTGACAGTATTAGG + Intergenic
1044650403 8:94487833-94487855 ATTCCCAAAATAATAGTATTAGG + Exonic
1045115955 8:98979905-98979927 ATTGCCATTGTAAAGGTATCGGG - Intergenic
1045728632 8:105206266-105206288 GTTACCATTGTAATTGTTTTGGG - Intronic
1045947918 8:107817625-107817647 GTTGCCATTGTAACTGTATTAGG - Intergenic
1045991473 8:108313927-108313949 ATTGCCACAGTAATGGTATTGGG - Intronic
1046060069 8:109128438-109128460 ATTACCAGTGTGCTAGTATTAGG - Intergenic
1046237552 8:111446568-111446590 ATTGCCATTATGACAGTATTAGG - Intergenic
1046283319 8:112062161-112062183 ATTGCCAATGTAACAGTATTGGG + Intergenic
1046334688 8:112770226-112770248 ATTGCCAATGTAATGGTATGAGG + Intronic
1046875650 8:119251944-119251966 ATTTCCACCGTAATTGTATTTGG + Intergenic
1046927689 8:119809805-119809827 ATTACAATTGTAATTGTTTTGGG - Intronic
1047438108 8:124852097-124852119 ATTGCCATTATTATTGTACTTGG - Intergenic
1047629144 8:126687638-126687660 ATTGACATTGCAATAATGTTGGG + Intergenic
1047703613 8:127474798-127474820 ATTACTATTGTAATTGTTTTGGG + Intergenic
1048142797 8:131811169-131811191 ATCCCCATTGTAATGGTATTTGG + Intergenic
1048734258 8:137480985-137481007 ATTTCCAGTGTGATAGTATTTGG - Intergenic
1049055972 8:140237859-140237881 TTTGCCATTTTAGTAGTTTTTGG - Intronic
1049331305 8:142055489-142055511 ACCTCCGTTGTAATAGTATTTGG + Intergenic
1050095188 9:2057382-2057404 ACTCCCAATGTAATGGTATTAGG - Intronic
1050769275 9:9176561-9176583 ATTGCTAATGTAATGGTGTTGGG + Intronic
1051026549 9:12619868-12619890 ATTCCCAATGTGATGGTATTTGG + Intergenic
1051297500 9:15611893-15611915 ATTGCCATTGTGATGGTATTAGG + Intronic
1051298235 9:15618996-15619018 ACTGCTATTGTAATTGTTTTGGG + Intronic
1051453079 9:17219982-17220004 ATAACCAATGTCATAGTATTTGG - Intronic
1051699298 9:19802847-19802869 ATTCCCAATGCAATAGTATTAGG + Intergenic
1052116705 9:24657186-24657208 GTTGCCATTGTAACAGTGTTGGG - Intergenic
1052129055 9:24818626-24818648 ATTTCAATTGTGAAAGTATTAGG + Intergenic
1052191162 9:25664290-25664312 ATTCCCAATGTGATGGTATTTGG + Intergenic
1052761231 9:32594031-32594053 ATTGTCATCTTAATAATATTTGG - Intergenic
1053049301 9:34945536-34945558 ATTGCCATTGTGACGGTATTAGG + Intergenic
1053258565 9:36640835-36640857 ATCACTAGTGTAATAGTATTAGG - Intronic
1053319851 9:37087119-37087141 ATTGGCATTGGCATAGTAGTAGG + Intergenic
1053406001 9:37876716-37876738 ACTTCCAATGTGATAGTATTTGG + Intronic
1055143766 9:72907943-72907965 AATGCCATTGTAACAGCAATAGG - Intronic
1055402418 9:75938401-75938423 GTTGCTATTGTAATTGTTTTAGG - Intronic
1055528979 9:77164407-77164429 ATTGTCATTGTAACAGCGTTAGG - Intergenic
1055545087 9:77362708-77362730 ATTGCCATCCTAACAGTATTAGG + Intronic
1055570620 9:77613195-77613217 ATTCTCAATGTGATAGTATTTGG - Intronic
1055653375 9:78430185-78430207 ATTGTCAGTGTGATGGTATTTGG + Intergenic
1055661119 9:78505150-78505172 GTTCCCATTGTGATAGTGTTAGG + Intergenic
1055727795 9:79250203-79250225 ATTCCCACTGCAACAGTATTGGG - Intergenic
1056227199 9:84507289-84507311 ATTACTATTGTAATTGTTTTGGG + Intergenic
1057706352 9:97397804-97397826 ATTCCCAATGTGATAATATTAGG - Intergenic
1058295913 9:103306248-103306270 ATAGACATTTTAACAGTATTAGG - Intergenic
1058320453 9:103623718-103623740 ATTGCCATTGTAATGGTAAATGG + Intergenic
1058331574 9:103767941-103767963 ATCCCCATTGTGATGGTATTTGG + Intergenic
1059265586 9:113026507-113026529 ATTGCCAGTATAATGGTACTGGG + Intergenic
1059288684 9:113201482-113201504 ATTCCCAGTGTGACAGTATTAGG + Intronic
1059524777 9:114980521-114980543 ATTCCCAATGTGATGGTATTTGG + Intergenic
1059879256 9:118671799-118671821 ACCCCCATTGTGATAGTATTAGG - Intergenic
1059983029 9:119794198-119794220 ATCACCAATGTGATAGTATTAGG + Intergenic
1060321961 9:122570829-122570851 ATTGAAAATGTATTAGTATTAGG + Intergenic
1186115521 X:6301466-6301488 ATTCCCACTGCAATGGTATTTGG - Intergenic
1186194620 X:7098487-7098509 ATTGCCAGTGTGATAGGATTAGG - Intronic
1186256024 X:7720790-7720812 ATTACTATTGTAATTGTGTTGGG - Intergenic
1186320660 X:8420955-8420977 ATCTCCAATGCAATAGTATTAGG + Intergenic
1186662368 X:11681844-11681866 ATTGGCATTAAAATACTATTGGG - Intergenic
1186951532 X:14631039-14631061 ATTCCCAGTGCAACAGTATTGGG - Intronic
1187598020 X:20796422-20796444 ATTGCCAATGTAGTGGTGTTGGG + Intergenic
1187685358 X:21810517-21810539 ATTGCCAGTGTAACAGTGTTGGG - Intergenic
1188467126 X:30494237-30494259 ATTCCCAATTTAATTGTATTAGG - Intergenic
1188934042 X:36152078-36152100 ATCACCATTGTGATGGTATTAGG - Intergenic
1188944153 X:36277735-36277757 ATGGCTAATGTAATATTATTTGG - Intronic
1188947750 X:36328355-36328377 ATTGCCATTTTAACAATATTAGG - Intronic
1189008222 X:37016940-37016962 ATTGCCAGTGTAATGGTATTGGG + Intergenic
1189305344 X:39982785-39982807 ATGGCCAATGCAATAGTGTTGGG - Intergenic
1189494575 X:41497667-41497689 ATTGCCAGTGTAGTGGTATTAGG + Intergenic
1189524739 X:41808179-41808201 ATTGCCGTTGTAACAGTATTGGG - Intronic
1189851770 X:45184858-45184880 ATTGAAATTGTAATAATATCAGG - Intronic
1189965088 X:46364222-46364244 ATTACTATTGTAATTGTTTTTGG - Intergenic
1189971248 X:46420385-46420407 ATTGCCATTGTAATGGAATTGGG - Intergenic
1190139997 X:47834645-47834667 ATTGCCATTGTAACAGTATTAGG + Intergenic
1190370801 X:49738947-49738969 CTTGCCTTTGTAAAAATATTAGG + Intergenic
1190487291 X:50940391-50940413 ATTCCCAGTGTGATGGTATTTGG - Intergenic
1190855178 X:54287174-54287196 AATGCCTTTGGGATAGTATTTGG + Intronic
1191681983 X:63850445-63850467 ATTGCCATTGTGATGGTATTAGG + Intergenic
1192217749 X:69175693-69175715 ATTGCCAATGTAATGGAATTGGG + Intergenic
1192432151 X:71119593-71119615 AATGCCAATGAGATAGTATTAGG - Intronic
1193231508 X:79052262-79052284 ATCACCAATGTGATAGTATTAGG - Intergenic
1193247171 X:79242904-79242926 ATTTCCAATGTGATGGTATTTGG - Intergenic
1193252188 X:79304360-79304382 AATGACATTGGAATAGTAATAGG - Intergenic
1193331102 X:80236650-80236672 TTTTCCTTTGTAATACTATTTGG - Intergenic
1193427932 X:81362943-81362965 ATTGTCAGTGTAATATTATATGG - Intergenic
1193662224 X:84271466-84271488 CTTGCCAATGTAGTGGTATTGGG + Intergenic
1194120785 X:89961148-89961170 GTTGCTATTGTAATTGTTTTGGG + Intergenic
1194155804 X:90387219-90387241 ATTGTCATTGTGATGGTGTTGGG - Intergenic
1194270328 X:91806078-91806100 ACTGCCTTTGTAATAGCATGTGG + Intronic
1194448706 X:94016330-94016352 TTTACTATTGTAATAGGATTTGG - Intergenic
1194805244 X:98319085-98319107 GTTGCCAATATAATGGTATTTGG - Intergenic
1194829318 X:98601276-98601298 ATTGCCAATGTAGCACTATTAGG + Intergenic
1195251758 X:103054718-103054740 ATCCCCAATGTAATGGTATTTGG + Intergenic
1195277389 X:103295121-103295143 ATTGCCATTTTAATGATATTAGG + Intergenic
1195291751 X:103436868-103436890 ATTGCCATTGTGACTTTATTAGG + Intergenic
1196435275 X:115668534-115668556 AATGCCATTATCATAGGATTGGG - Intergenic
1196716581 X:118817109-118817131 ATTGCCATTTTATCAATATTTGG + Intergenic
1196920680 X:120582326-120582348 TTTGCCATTGTAATATTTTAAGG - Intergenic
1196931314 X:120684509-120684531 ATCCCCAATGTAATAGTATTAGG - Intergenic
1197182626 X:123552545-123552567 AATCCCAATGTGATAGTATTTGG - Intergenic
1197577980 X:128244847-128244869 ACTTCCAATGTAACAGTATTTGG + Intergenic
1197640938 X:128967456-128967478 ATTGCCATTGTGACAGTATTGGG - Intergenic
1197672789 X:129297152-129297174 ATTGCCACTGTGATGGTATTGGG + Intergenic
1197788406 X:130224107-130224129 ATTTTCAATGTAATAGTATTGGG + Intronic
1198136423 X:133755494-133755516 ATTGCCAGTGTAGTTCTATTGGG + Intronic
1198608112 X:138366947-138366969 ACTGCCACCTTAATAGTATTAGG + Intergenic
1198616277 X:138462335-138462357 CATACCATTGTAATAGAATTAGG - Intergenic
1198887954 X:141360055-141360077 ATTGCCATTGTCGTCCTATTCGG + Intergenic
1199045817 X:143170295-143170317 ATTTCCAATGTGATGGTATTAGG - Intergenic
1199208366 X:145176191-145176213 ATCCCCATTGTATCAGTATTGGG + Intergenic
1199244756 X:145590514-145590536 ATAGCCATTGTAATAGGTATGGG + Intergenic
1199379373 X:147150210-147150232 AATCCCAGTGTAATGGTATTTGG - Intergenic
1200020232 X:153197751-153197773 ATTGCTATTGTAATCACATTGGG + Intergenic
1200203955 X:154302594-154302616 AATGCCAGTGTGACAGTATTTGG - Intronic
1200413117 Y:2881045-2881067 GTAGCCATTGTAATAGTGTTGGG + Intronic
1200473650 Y:3618653-3618675 GTTGCTATTGTAATTGTTTTGGG + Intergenic
1200502153 Y:3964161-3964183 ATTGTCATTGTGATGGTGTTGGG - Intergenic
1200587561 Y:5027522-5027544 ACTGCCTTTGTAATAGCATGTGG + Intronic
1201401069 Y:13604501-13604523 ATAGTGATGGTAATAGTATTTGG + Intergenic
1201597121 Y:15682838-15682860 ATTGCCAGGGTGATGGTATTAGG + Intergenic
1201866516 Y:18661391-18661413 AAGGCCTTTGTAATAGCATTGGG - Intergenic
1201983331 Y:19931496-19931518 GTGGCCATTGCAATAGTGTTAGG + Intergenic
1202053771 Y:20807818-20807840 CTGGCCATTGTGATAGTGTTGGG + Intergenic