ID: 1092044149

View in Genome Browser
Species Human (GRCh38)
Location 12:5415360-5415382
Sequence AATATCAACGTGAGTTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092044144_1092044149 8 Left 1092044144 12:5415329-5415351 CCACTTCCCAATACTATTACAAT No data
Right 1092044149 12:5415360-5415382 AATATCAACGTGAGTTTTGGTGG No data
1092044147_1092044149 1 Left 1092044147 12:5415336-5415358 CCAATACTATTACAATGGCAATT No data
Right 1092044149 12:5415360-5415382 AATATCAACGTGAGTTTTGGTGG No data
1092044143_1092044149 21 Left 1092044143 12:5415316-5415338 CCTTTTAATGGATCCACTTCCCA No data
Right 1092044149 12:5415360-5415382 AATATCAACGTGAGTTTTGGTGG No data
1092044146_1092044149 2 Left 1092044146 12:5415335-5415357 CCCAATACTATTACAATGGCAAT 0: 2
1: 12
2: 56
3: 171
4: 776
Right 1092044149 12:5415360-5415382 AATATCAACGTGAGTTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092044149 Original CRISPR AATATCAACGTGAGTTTTGG TGG Intergenic
No off target data available for this crispr