ID: 1092048736

View in Genome Browser
Species Human (GRCh38)
Location 12:5452738-5452760
Sequence CCCCCACCTAGGGCAGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092048730_1092048736 -3 Left 1092048730 12:5452718-5452740 CCTGTGTGTACTCACGCATCCCC 0: 1
1: 0
2: 0
3: 16
4: 90
Right 1092048736 12:5452738-5452760 CCCCCACCTAGGGCAGCCTTGGG 0: 1
1: 0
2: 0
3: 18
4: 200
1092048727_1092048736 28 Left 1092048727 12:5452687-5452709 CCACAGGATAGCGGAAAGGCACA 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1092048736 12:5452738-5452760 CCCCCACCTAGGGCAGCCTTGGG 0: 1
1: 0
2: 0
3: 18
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092048736 Original CRISPR CCCCCACCTAGGGCAGCCTT GGG Intronic
900097500 1:945956-945978 CCCCAACCTAGTGCAGCCTGGGG + Intronic
900157898 1:1210910-1210932 CCTCCACCCCAGGCAGCCTTGGG + Intergenic
900891540 1:5453357-5453379 CCACCACCTGGGGAAGACTTTGG - Intergenic
902575063 1:17372472-17372494 GCCCCATCTTGGGAAGCCTTGGG + Intronic
902580141 1:17402908-17402930 CCTCTACCAAGGGCTGCCTTAGG + Intergenic
903164925 1:21513670-21513692 CCCCCACCCCCTGCAGCCTTAGG - Intronic
903209986 1:21812481-21812503 CCCCCAGCAAGAGCAACCTTTGG - Exonic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906510176 1:46406174-46406196 CCCAGACCTAGAGCAGCCTGGGG - Intronic
906966922 1:50466886-50466908 CCACCAGCTAGGGCAGCTTGAGG - Intronic
907340546 1:53732312-53732334 CCCCTACCCAGCCCAGCCTTCGG + Intronic
909501295 1:76338042-76338064 CCCCCACGCAGGGCAGCTGTTGG - Intronic
910105116 1:83623872-83623894 CCACCACCCAGAGCAGCTTTAGG - Intergenic
912414261 1:109497514-109497536 TCACCACCGAGGGCAGCCTGGGG - Intronic
913227166 1:116710445-116710467 CTCCCAGCAAGGGCAGCCCTTGG + Intergenic
916058108 1:161081809-161081831 CCCCCACCCCAGGCAGCATTAGG + Intronic
921925503 1:220707256-220707278 ACCACACCTAGGGCAGCCTGTGG - Intergenic
922485951 1:225973100-225973122 TCCCCACCTAAGCCAGCCCTGGG + Intergenic
923106452 1:230857447-230857469 CCCCCACATTGGGAAGTCTTGGG - Intronic
923565711 1:235074350-235074372 TCTCCACCTTGGGCAGCCCTGGG - Intergenic
1064326290 10:14354474-14354496 ACCCCACATAGGTCAGCCTCTGG - Intronic
1065170595 10:23023120-23023142 CCCCTGCCTAGGGAAGCCTCTGG + Intronic
1065630307 10:27673764-27673786 CCATCAACTAGAGCAGCCTTTGG + Exonic
1067047615 10:42993323-42993345 CCTCCACCTATGGCAGGCCTTGG + Intergenic
1067972970 10:50992387-50992409 TCCAAACCTAGAGCAGCCTTAGG - Intronic
1069914957 10:71781734-71781756 CTCCCACCCAGGTCAGCCTTAGG - Intronic
1073250513 10:102118068-102118090 CCCCCACCTTGAGCAGCCCTGGG - Intronic
1073593246 10:104776310-104776332 CCCCAACCTTGGGGAGCTTTAGG - Intronic
1074883026 10:117673129-117673151 CCCCTGCCTATGGCAGGCTTGGG - Intergenic
1076158343 10:128221467-128221489 CCCACAACAAGGTCAGCCTTGGG - Intergenic
1076847446 10:133076239-133076261 CCCCCACCTTGGGCACCCTCAGG + Intronic
1076988587 11:257248-257270 CCCCCAGCCAGCCCAGCCTTGGG + Intergenic
1077352670 11:2100106-2100128 CCCCCACCCAGGCCAGCCTCAGG - Intergenic
1077414841 11:2420186-2420208 CAGCCACCCAGGGAAGCCTTGGG - Intronic
1081670063 11:44937729-44937751 TCCCCACCTGGGGGAACCTTTGG - Intronic
1083200742 11:61119606-61119628 ACCCCACCTAGGGCAGCAGAAGG - Intronic
1084604199 11:70162834-70162856 TCCCCACCCAGGGTGGCCTTTGG + Intronic
1084882460 11:72181475-72181497 CCTGGTCCTAGGGCAGCCTTCGG + Intergenic
1086037867 11:82438716-82438738 TCCCCACCTTGTGCAGCCTCAGG - Intergenic
1088130463 11:106483071-106483093 CCCACACTTAGGGCACACTTAGG - Intergenic
1088423504 11:109674831-109674853 CCACGCCCTAGGGCAGACTTTGG - Intergenic
1089139210 11:116272972-116272994 CACCCCCCTAGGGCAGCCAGGGG + Intergenic
1089621236 11:119723528-119723550 CCCCCACCCAGGGCAAACCTGGG + Intronic
1089638935 11:119834178-119834200 GCCCCACCTGGGCCATCCTTAGG - Intergenic
1090715842 11:129430049-129430071 CCTCCACAGAGGGCAGCCCTTGG + Intronic
1092048736 12:5452738-5452760 CCCCCACCTAGGGCAGCCTTGGG + Intronic
1099285187 12:80708094-80708116 TCTCCACCTTGGGCAGCCTCTGG - Exonic
1099286342 12:80717408-80717430 TCTCCACCTTGGGCAGCCTCTGG - Exonic
1099973849 12:89525911-89525933 CCCCCACCCACAGGAGCCTTGGG - Exonic
1102028402 12:109726513-109726535 CACCCACCCCGGGCAGCCATGGG + Intronic
1103513788 12:121493509-121493531 ATCCCACCTAGGACCGCCTTTGG + Intronic
1104930963 12:132339295-132339317 GCCCCACCTGGGCCAGCCTCCGG + Intergenic
1106473804 13:30080342-30080364 TCTCTACCTTGGGCAGCCTTAGG - Intergenic
1107132514 13:36911603-36911625 CCCCCCCCCCAGGCAGCCTTTGG - Intronic
1112308998 13:98301191-98301213 CCCCCACCTGGAGGAGCCCTGGG + Intronic
1113600780 13:111566731-111566753 CCCCCTCCAACGACAGCCTTTGG - Intergenic
1113758616 13:112832242-112832264 CCCGCACACAGGGCAGCCTCGGG + Intronic
1115938556 14:38583090-38583112 CCCCCACAGAAGGCAGCTTTTGG + Intergenic
1117002669 14:51386901-51386923 CCCCCACCTAAGGCATAATTAGG + Intergenic
1118714385 14:68548779-68548801 CCCCCACCCAGGGCACACTGGGG + Intronic
1119810294 14:77512231-77512253 CCCTCACCCAGGACAGCCTGTGG - Exonic
1121266204 14:92604131-92604153 CACCCACCTTGGCCAGCCTGTGG - Intronic
1121718936 14:96095895-96095917 TCCCCAGCGAGGGCAGGCTTTGG - Intergenic
1122093397 14:99354377-99354399 ACTCCACCTAGGGCACCCCTAGG + Intergenic
1122855735 14:104559327-104559349 CCTGCACCAAGGGCAGCCCTGGG - Intronic
1124432247 15:29617784-29617806 CCACCACCTTGTGCAGCCATCGG - Intergenic
1124617060 15:31249414-31249436 CTCCCACCAATGGCAGCCTGTGG - Intergenic
1125524340 15:40365658-40365680 CCACCTCCTCGGGCAGCCTATGG + Exonic
1128521112 15:68375488-68375510 CCCCCAGCCAGGGCAGCCCCGGG - Intronic
1128800285 15:70492788-70492810 CTAACCCCTAGGGCAGCCTTGGG + Intergenic
1129475775 15:75783772-75783794 CCCCCAGCTGGAGCTGCCTTTGG - Intergenic
1129839608 15:78735544-78735566 CCCCCAGCTGGAGCTGCCTTTGG - Intergenic
1131831814 15:96359497-96359519 TCCCCACCTCGGGGAGTCTTGGG - Intergenic
1132344959 15:101102543-101102565 CCCCCACCCCTGGCAGCCATGGG + Intergenic
1132669076 16:1095340-1095362 CCCCACCCCAGGCCAGCCTTGGG - Intronic
1133204679 16:4226251-4226273 CCTGCACCTAGGGCAGCCATTGG + Intronic
1133300469 16:4779394-4779416 CCAGCCACTAGGGCAGCCTTGGG + Intronic
1133344239 16:5059624-5059646 CCTGCACCTAGGGCTGCCCTGGG + Intronic
1136998087 16:35204919-35204941 CCCCCAACTAAGACAGCCTGAGG + Intergenic
1137426630 16:48385581-48385603 CCCGCACCTACTGCCGCCTTTGG - Intronic
1140743576 16:77962386-77962408 CCCCTACCTATGGCTCCCTTTGG - Intronic
1142667644 17:1471769-1471791 CCTCCACCAAGGGCAGCCCAGGG + Intronic
1144784513 17:17824224-17824246 CCCCCTTCTAGGGCAGCCCCAGG + Intronic
1145992203 17:29085935-29085957 GGTCCACCTAGGGCAGCCCTGGG + Intronic
1147681584 17:42251145-42251167 CCCCCAAATATGGCATCCTTTGG - Intronic
1147852953 17:43456610-43456632 ACCCCATTTAGGGCAGCCTCAGG - Intergenic
1150306370 17:64088747-64088769 TCCCCACCTAGGAAAGCCTGTGG - Intronic
1151493969 17:74448697-74448719 CCACCTTCCAGGGCAGCCTTGGG - Intronic
1152460108 17:80438183-80438205 CCCCTCCCCAGAGCAGCCTTGGG - Intergenic
1152729282 17:81961708-81961730 GCCCCACCTCGCGCAGCCCTGGG + Intronic
1160515754 18:79478422-79478444 CCCTCACCCAGGGCAGACCTGGG - Intronic
1160969619 19:1761751-1761773 ACCTGACCTTGGGCAGCCTTGGG + Intronic
1163153604 19:15428541-15428563 CCGCCACCTTGGCCGGCCTTGGG + Intronic
1163359344 19:16836078-16836100 TCCCAGCCTCGGGCAGCCTTTGG + Intronic
1165385916 19:35510629-35510651 CCCCCATCTAGGGCAGTTCTGGG - Intronic
1165928446 19:39341947-39341969 CGCCCACTGAGGACAGCCTTGGG + Intronic
1166300114 19:41908352-41908374 TTCCCACCAAGGGCAGCCTCTGG + Intronic
1167448734 19:49554957-49554979 CCCCCACCTGTGGCAGCCTGAGG - Intergenic
1167456610 19:49599596-49599618 CCCCCACCTTCCGGAGCCTTTGG + Exonic
925134225 2:1515207-1515229 CCCCCACCTCTAGCAGCCATGGG + Intronic
927888172 2:26731075-26731097 CCCCCACCCCGGGCAGCCCCCGG + Exonic
932094036 2:68831246-68831268 ACCCCACCTAAGGCAGCCAGGGG - Intergenic
932581810 2:72996965-72996987 CTCCCACTCAGGGGAGCCTTTGG + Intronic
933759690 2:85665121-85665143 CCCCCACCCAGGGGACCCTGGGG - Intronic
934098017 2:88625642-88625664 CTGCCACCCAGGGCATCCTTGGG + Intronic
936060707 2:109293950-109293972 CCCCCACCCAGGGAAGCTCTTGG - Intronic
939063785 2:137457390-137457412 CCCTGCCCAAGGGCAGCCTTAGG - Intronic
942452485 2:176116942-176116964 CCACCACCTAGCGCAGACATGGG + Exonic
942951567 2:181728075-181728097 CCCCCACCTTCAGCTGCCTTAGG + Intergenic
944535400 2:200704725-200704747 CCCTCACCTAGGCCAGGCTGAGG - Intergenic
946219349 2:218213216-218213238 CCCCCATCTGTGGAAGCCTTAGG - Intergenic
946302299 2:218831352-218831374 CCCCTTCCTGGAGCAGCCTTGGG - Exonic
948423645 2:237875206-237875228 CCCCCAGTCAGGGCAGCCTTGGG - Intronic
948978311 2:241478329-241478351 CACCTGCCTGGGGCAGCCTTAGG + Intronic
1170705068 20:18737521-18737543 CCCCTGCCTTGGGCTGCCTTGGG + Intronic
1170784544 20:19456161-19456183 CCCACAGTTAGGGTAGCCTTTGG + Intronic
1172872409 20:38144006-38144028 CCTTCACTGAGGGCAGCCTTAGG - Intronic
1173814304 20:45975284-45975306 ACCCCACCCAGGCCAGCCTGGGG + Intergenic
1174105719 20:48161039-48161061 CCCCCACTGAGGGCTGACTTTGG + Intergenic
1175497031 20:59422410-59422432 CCCCAACCTGGGCCAGCCTTTGG + Intergenic
1175953091 20:62593820-62593842 CCCCAACCTGGGGCATCCTTTGG + Intergenic
1175959563 20:62628613-62628635 CCCCCTCCTAGGGCATACTTTGG + Intergenic
1175996063 20:62812868-62812890 CCCTCAGCCAGGGCAGCCTCAGG + Exonic
1176002142 20:62837102-62837124 CGCGCACCTAAGGAAGCCTTTGG + Exonic
1176120097 20:63450417-63450439 CCCACACCTGGGGCAGCCCCAGG - Intronic
1178030196 21:28517141-28517163 CACACACCTGGGGCAGTCTTGGG + Intergenic
1178535035 21:33403790-33403812 CCCCCACCTGGGGCACCCGCAGG - Intronic
1179541544 21:42086135-42086157 CCCCCAGGGAGGGCGGCCTTGGG - Intronic
1179726006 21:43341568-43341590 CCCTCACCCCGGGCAGCCTAGGG - Intergenic
1181045514 22:20212325-20212347 CCACCACCCAGGGAAGCCTGGGG - Intergenic
1181694213 22:24584941-24584963 CCCCTGCCAAGGGCAGCCCTAGG + Intronic
1181787598 22:25238258-25238280 CTCCCTCCTAGGGCAGCCCCTGG + Intergenic
1181819339 22:25463296-25463318 CTCCCTCCTAGGGCAGCCCCTGG + Intergenic
1182728630 22:32469408-32469430 GCGCCACATAGGGCAGTCTTGGG + Intergenic
1183020699 22:35023882-35023904 CCCCCACCAAGGGAGGCCATGGG + Intergenic
1183260264 22:36790299-36790321 ACCCCACCCAGGGCTGCCTGTGG + Intergenic
1184569887 22:45315822-45315844 CCCCCACCTGAAGCAGCATTAGG - Intronic
1184828914 22:46971766-46971788 CTCCCACCTTGGGCTGCCGTGGG + Intronic
950040305 3:9915704-9915726 CCACCAGCTGGGGCCGCCTTGGG + Exonic
950486480 3:13276863-13276885 CCCCCACCCAGGGCAGACCCGGG - Intergenic
951835811 3:26982450-26982472 CCAGCACCTAGGGCATCATTTGG - Intergenic
952424295 3:33159139-33159161 CCATCACCTAGGACTGCCTTTGG - Intronic
953695264 3:45153282-45153304 CCCCATCCTAAGGCAGGCTTAGG + Intergenic
954638819 3:52085964-52085986 GCCCCAAATAGGGCAGCCTGTGG + Intronic
956316345 3:67942021-67942043 CCCCCACGTAAGACAGTCTTAGG + Intergenic
959442717 3:106398113-106398135 CCCCGACCTAGAGAAGCCTCAGG - Intergenic
960314964 3:116165425-116165447 CCCCCACCTAGTGGAGCAATTGG + Intronic
961010099 3:123429899-123429921 CCCACCCCCAGGGCAGCCGTTGG - Intronic
961332679 3:126152185-126152207 TCCCCACCTCTGTCAGCCTTTGG - Intronic
963206521 3:142641805-142641827 CTGACACCTAGGGCAGCTTTGGG + Intronic
964976228 3:162623403-162623425 ACCCCAGCTAGGGCAGCCAAGGG - Intergenic
965604581 3:170485647-170485669 TCCCTACCTAGGGGAGCCTCAGG - Intronic
968913084 4:3485617-3485639 CCCCCACCAAGGGCCCCTTTGGG + Exonic
969332850 4:6489945-6489967 CCCTCCCCTAGGCCAGCCTTGGG + Intronic
969907975 4:10415227-10415249 CCCCCACCCAAGGATGCCTTTGG - Intergenic
970213199 4:13732140-13732162 CTCCCACCCAGGGCATCCCTGGG + Intergenic
971237805 4:24858699-24858721 CCCACACCCAGGGCTGGCTTTGG - Intronic
978385586 4:108172865-108172887 TCTCCCCCTTGGGCAGCCTTAGG - Intergenic
979278775 4:118841276-118841298 ACCCCACCAAGTGCAGTCTTTGG - Intergenic
980396847 4:132225802-132225824 CCCCCACCTAAAGCAGCCATTGG - Intergenic
983453024 4:167930400-167930422 TCCCCTCCCAGGGCAGCCTTGGG + Intergenic
986083981 5:4424454-4424476 CCCCAGCCGAGGGCAGCCATGGG - Intergenic
986205721 5:5623388-5623410 CCACCACCCCGTGCAGCCTTGGG + Intergenic
986645441 5:9912234-9912256 CCCCCACCTGGGAGAGCCATGGG + Intergenic
997464792 5:134079973-134079995 CCCCCACCGCAGGCCGCCTTTGG - Intergenic
1001587946 5:172845906-172845928 CCCCCACCCAGAGGAGCCTGGGG - Intronic
1005974565 6:30788213-30788235 CCCGTACAAAGGGCAGCCTTGGG + Intergenic
1006439420 6:34043807-34043829 CCTCCACCCAGGGCAGCTCTGGG + Intronic
1009795123 6:68456467-68456489 CCCCAGCCAAGGGAAGCCTTAGG - Intergenic
1015549343 6:134395877-134395899 CCCCCACTGAAGCCAGCCTTAGG - Intergenic
1017716915 6:157219141-157219163 CCCCCACCTAGGCCTGCTTGTGG - Intergenic
1017816424 6:158019569-158019591 GCCTCGCCTAGGGCAGCCCTGGG - Intronic
1017929528 6:158939705-158939727 CTCCCACCTGGGTCAGCCTCCGG + Intergenic
1018807074 6:167270034-167270056 CCCCCACCCCGTGCAGCCTCTGG - Intergenic
1019111781 6:169723552-169723574 CCTCCTCCTAGGCCAGCCGTGGG - Intronic
1019153311 6:170023306-170023328 GCCCCACCTAGGGCGGCCGCCGG - Intergenic
1019160003 6:170063289-170063311 CCACTGCCTAGGGCAGACTTTGG - Intergenic
1019349654 7:548589-548611 ACCCCTCCCGGGGCAGCCTTGGG + Intergenic
1022340415 7:29462616-29462638 CCCCCAAACATGGCAGCCTTGGG + Intronic
1023349661 7:39308266-39308288 CCCCAACCTAGGGCAGTGTTGGG + Intronic
1025275959 7:57581251-57581273 TCCCCAAGGAGGGCAGCCTTGGG + Intergenic
1026187391 7:68092512-68092534 TCCCCACCCAAGGCAGCCTCAGG + Intergenic
1026674228 7:72415852-72415874 CCTTCACCTAGGGCTTCCTTTGG + Intronic
1029273747 7:99392465-99392487 CCCCCAGCAAGGCCAGCGTTGGG - Intronic
1033982575 7:147184274-147184296 CCCACAAGTTGGGCAGCCTTAGG - Intronic
1034285033 7:149878843-149878865 CCCACACCCAGGGCAGGCCTCGG + Intronic
1034959376 7:155355481-155355503 TCTCCACCGGGGGCAGCCTTGGG - Intergenic
1037879684 8:22566582-22566604 CCCCCACCTAGGGCAGGCACTGG - Intronic
1038040852 8:23722834-23722856 CCCCCACTTCGGGCTGCCTGGGG + Intergenic
1039592072 8:38757423-38757445 CCCTCTCCAAGGGCCGCCTTTGG + Intronic
1040331012 8:46385756-46385778 ATCCCACCCAGGACAGCCTTTGG - Intergenic
1040342723 8:46449020-46449042 CCCTAACCTAGGGAAGCCTCGGG + Intergenic
1040534556 8:48297446-48297468 CCCCCACCTAGAGCAGTTTGAGG - Intergenic
1041375146 8:57204807-57204829 CCCCCACCAAGGGAAGCATCAGG - Intergenic
1042100346 8:65269773-65269795 CCGCCAGCTAGGCCATCCTTGGG - Intergenic
1044841736 8:96343001-96343023 ACCTGAACTAGGGCAGCCTTTGG + Intergenic
1045245890 8:100441429-100441451 ACCCCAGCTAGTGAAGCCTTAGG - Intergenic
1047692919 8:127374655-127374677 CCCACACCTAAGGCAGCTTCTGG - Intergenic
1049521599 8:143094301-143094323 CCCCCACCTGGGTGAGCCCTGGG + Intergenic
1049688117 8:143947127-143947149 CCTCCACCTAGAGCACCCTGTGG + Intronic
1050718829 9:8561582-8561604 CCCCCACCTTGCTCAGCCCTGGG - Intronic
1055645380 9:78357475-78357497 CCCCCTCCATGGGCAGACTTTGG + Intergenic
1058200465 9:102032966-102032988 CCCCTACCTATGGCTGCCTATGG + Intergenic
1059251755 9:112892222-112892244 CCCTCACCTAGGGTCACCTTGGG + Intergenic
1060794495 9:126504798-126504820 CCCCCACCAGGGGCATCCTCGGG - Exonic
1061009061 9:127944599-127944621 CCACCAGGTAGGGCAGGCTTAGG - Exonic
1061208485 9:129177527-129177549 GCCCCACCGCGGGCAGCCCTTGG - Exonic
1061483401 9:130908456-130908478 CCCCCAGCTTGGGGAGCCTGAGG + Intronic
1061664596 9:132153163-132153185 CCCTTACCTAGCACAGCCTTTGG - Intergenic
1062586676 9:137252760-137252782 CACCCACCTAGGGCTGCCTGGGG + Exonic
1185660849 X:1727785-1727807 CCCCAAACTGGGGCAGCCTGGGG + Intergenic
1186491596 X:9977850-9977872 ACCCCACTTATGTCAGCCTTTGG - Intergenic
1189083392 X:37996700-37996722 CTCCCACCTAGAGCATCTTTTGG + Intronic
1190323466 X:49191849-49191871 CCCCCACCTTGCGGAGCCTACGG - Intronic
1190602715 X:52108817-52108839 GCACCAGCTAGGGCAGCCTAGGG - Intergenic
1193735969 X:85156698-85156720 CACATACCTAAGGCAGCCTTGGG + Intergenic
1195755115 X:108192302-108192324 CCCCCACATACGTTAGCCTTGGG + Intronic
1195897202 X:109758686-109758708 CCACCACCTATCCCAGCCTTTGG - Intergenic
1200232020 X:154448840-154448862 GCCCCACTGAGAGCAGCCTTGGG - Intronic