ID: 1092050451

View in Genome Browser
Species Human (GRCh38)
Location 12:5465982-5466004
Sequence CAGCTCTACCACTTACAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 1, 2: 11, 3: 68, 4: 350}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092050451 Original CRISPR CAGCTCTACCACTTACAAGT TGG (reversed) Intronic
901287854 1:8095730-8095752 CTGTTCTGCCACTTACTAGTAGG - Intergenic
901930109 1:12591710-12591732 CAGCTCTACCGCTTACCGCTTGG - Intronic
902412333 1:16218663-16218685 TGGCTCCACCACTTACAATTTGG - Intergenic
902623862 1:17665587-17665609 CAGTTCTGCCACTTACATCTGGG + Intronic
902700474 1:18168810-18168832 CAGCTTTGTCACTTACAAGCTGG - Intronic
903418324 1:23200130-23200152 CAGCTCTGCCACTGACCAGCTGG + Intergenic
903894024 1:26590940-26590962 CAGCTCTACCACTTTCTAAAAGG - Intergenic
904883491 1:33718120-33718142 TAGCTCTACCACATACTAGCTGG - Intronic
905218125 1:36424523-36424545 CAGCTCTGCCCCTTACCAGCTGG - Intronic
906075752 1:43050734-43050756 CAGCTCTACCATTTTTTAGTTGG + Intergenic
906890898 1:49712775-49712797 CAGCTCTACCACTTAGTATCTGG + Intronic
907154784 1:52323603-52323625 CAGCTCTACAAAATAAAAGTAGG + Intronic
907275839 1:53316199-53316221 CAGCTCTCCCACTTCCTGGTTGG - Intronic
908474518 1:64474384-64474406 CAGCTCTGCCATTTGCAAGTTGG + Intronic
908519425 1:64926778-64926800 CAGCTCTACCACGTGCCAGCTGG + Intronic
909089461 1:71207299-71207321 CAACTCTACCACTTACTATGTGG + Intergenic
909317773 1:74246138-74246160 TAGCTCTATCATTTATAAGTAGG - Intronic
910127431 1:83859728-83859750 CAGCTGCACCACTTACTAATGGG - Intergenic
910996384 1:93108681-93108703 CAGCTCAACAAATTCCAAGTAGG - Intronic
911037857 1:93569299-93569321 CAGCTCTACCACATACCAGCTGG - Intronic
911725110 1:101235139-101235161 CAGCTCTGCCACTCACTAGCTGG + Intergenic
911869695 1:103080301-103080323 CAGCCCTACCACATCCAAATAGG + Intronic
912810952 1:112794097-112794119 CAGGTTTATCACTTACAGGTAGG + Intergenic
915508213 1:156370781-156370803 CAGCTCTGCCACTCACATGATGG - Intronic
916578477 1:166087666-166087688 CAGCTCTGCCACTTACAAGCTGG - Intronic
917033911 1:170725537-170725559 CAGCTCTATCACCTCCAAGAGGG + Intronic
917121710 1:171650349-171650371 AAGCTCTACCACTGACCAGCTGG + Intronic
918422664 1:184379764-184379786 CAGCTCTGCCACTTATAGCTGGG + Intergenic
919531560 1:198727600-198727622 TAGCTCTACCACTTCTTAGTTGG - Intronic
920730702 1:208481271-208481293 CTGCTCTACCACTTACCAGCTGG - Intergenic
920760328 1:208777720-208777742 CAGCTCAGCCACTTACTAATTGG - Intergenic
922096025 1:222443417-222443439 CAGCTCCACCACTTGCTAGCTGG + Intergenic
922137261 1:222841454-222841476 CAGCTCTGACACTTACTAGCAGG - Intergenic
922159384 1:223067441-223067463 AAGGTCTGCCACTTACCAGTGGG + Intergenic
922557865 1:226546797-226546819 CAGCTCTACCACTGATTAGTGGG + Intergenic
922931288 1:229391649-229391671 CAGCTCTGCCACTTACTTGCTGG + Intergenic
923801259 1:237211501-237211523 CAGCTGTACCACGTACTAGCTGG - Intronic
924121500 1:240804107-240804129 AAGAACTACCACTTACAAATGGG + Intronic
924200545 1:241653853-241653875 TAGCTTTAACACTTAGAAGTTGG - Intronic
924422407 1:243921971-243921993 TAGCTCTACCACTTCCTAGCAGG - Intergenic
1062771653 10:105539-105561 GAGCCCTACCCCTTCCAAGTTGG - Intergenic
1063145480 10:3291279-3291301 CTGTTCTACCACTTACAATAAGG + Intergenic
1063441831 10:6079064-6079086 CTTCTATACCACTCACAAGTAGG + Intergenic
1064610640 10:17097896-17097918 CACCTCTCCCATTTAGAAGTGGG + Intronic
1064669230 10:17692168-17692190 CAGATCTACCACTTTCTAGCTGG - Intronic
1065323069 10:24526641-24526663 CAGCTCTGCCACTGACAAATGGG + Intronic
1067462503 10:46468123-46468145 CAGCCCTACCATCTACAAGTTGG - Intergenic
1067624692 10:47916514-47916536 CAGCCCTACCATCTACAAGTTGG + Intergenic
1068051309 10:51952401-51952423 GAGCTCTACTACTTACTAGCTGG + Intronic
1068129541 10:52880459-52880481 CAGCTCTGCTACTTACCAGCCGG + Intergenic
1068887404 10:62111699-62111721 CAGCTCTGCAACTCACAAGCTGG - Intergenic
1070540953 10:77414844-77414866 CAGCTCTGCCACTTACAAGATGG - Intronic
1071793608 10:88982122-88982144 CAGCTCTACAGCTTACTGGTTGG + Intronic
1072234745 10:93443893-93443915 CAGCTCTACTGATTACTAGTGGG - Intronic
1072535315 10:96358098-96358120 GATCTCTACCACTTAAAAGCTGG - Intronic
1072609079 10:97004688-97004710 CAGCTCTGCCATCTACAGGTAGG - Exonic
1073488501 10:103837330-103837352 TAGCTCTACCACTTGCTAGCAGG + Intronic
1073536059 10:104277585-104277607 CAGCTCTACTACTTCTTAGTGGG + Intronic
1075715380 10:124552307-124552329 CTGCTCTGCCACTTACAGCTGGG - Intronic
1078677883 11:13442415-13442437 CAGCTCTGCTATTTACAAGTTGG + Intronic
1079505175 11:21145282-21145304 CAATTCTACCACTTATAAGTTGG - Intronic
1080127563 11:28754865-28754887 CAGCTCTGCTACTTACTAGTGGG + Intergenic
1081104359 11:39046707-39046729 CTACTCCACCACTTACCAGTTGG + Intergenic
1081750836 11:45510076-45510098 CAGCTTTTCCACCTATAAGTGGG + Intergenic
1081793912 11:45806731-45806753 CAGCTCTGCCACTTATTAGCTGG - Intronic
1081862727 11:46342750-46342772 CACTTCTACCACTTACCAGCTGG + Intronic
1085084862 11:73660391-73660413 CAGCTCTACTAGTCACAAGGAGG - Intronic
1085193424 11:74649354-74649376 CAGCTCTACCATGTACTAGCTGG - Intronic
1085265705 11:75236741-75236763 CACCCCTACCACTTTCTAGTCGG + Intergenic
1085283107 11:75343629-75343651 CAGCTCTGACACTTACCAGCTGG - Intronic
1085432169 11:76462508-76462530 AAGCTGTACCACTTACCAGATGG - Intronic
1086006316 11:82042380-82042402 CAGCTCTACCACTTTCTAGCTGG + Intergenic
1086263383 11:84968789-84968811 CAGTTCTGCCACTAACATGTTGG - Intronic
1086892772 11:92277629-92277651 CAATGCTACCACTTACAAGTGGG - Intergenic
1086931131 11:92694515-92694537 CAGCTCTCCCAGTTACATGTAGG + Intronic
1087094158 11:94304584-94304606 CAGCTCTGCTACTTACTAGCTGG - Intergenic
1087922561 11:103883169-103883191 AATATCTACCACTTGCAAGTTGG - Intergenic
1088991458 11:114957216-114957238 CAGCTCTTCCTCTTACCAGCTGG + Intergenic
1089275254 11:117330915-117330937 CAGCTCTGCCTCTTACTAGCTGG - Intronic
1089947139 11:122487671-122487693 CAGCTCTGCCACTTACTAGCTGG - Intergenic
1090353809 11:126125617-126125639 CAGCTCTGCCACTCACCAGCTGG - Intergenic
1090640780 11:128727175-128727197 TAGCTCTGCCACTTATAAGCTGG + Intronic
1090821072 11:130342320-130342342 CAGCTCTGCCATTTTCTAGTTGG - Intergenic
1091109503 11:132952683-132952705 CAGCTCTGCTACTTCCAAGCAGG + Intronic
1091913564 12:4251130-4251152 CAGCTCTGTCACTTACTAGCTGG + Intergenic
1092050451 12:5465982-5466004 CAGCTCTACCACTTACAAGTTGG - Intronic
1092193915 12:6537771-6537793 CAGGTCCACCACTGACACGTTGG - Exonic
1094235257 12:28157102-28157124 CAGCTTTAGCACTTACAAGCTGG - Intronic
1096234985 12:49920411-49920433 TGGCTCCACCACTTACAAGCTGG + Intergenic
1097802153 12:63926430-63926452 CAGCTGGACCACTTGCAACTTGG - Intronic
1098205453 12:68104560-68104582 CAGCTCCACCACTTCCTAGCTGG - Intergenic
1098448422 12:70591369-70591391 TAGCTCTACCACTTACTGGCTGG + Intronic
1099477873 12:83129866-83129888 CAGCTCTACCACAGAGATGTGGG - Intronic
1100052131 12:90461539-90461561 TAGCTCTACCATTTTGAAGTCGG + Intergenic
1100566588 12:95800423-95800445 CAGCTCTATTATTTACTAGTTGG - Intergenic
1101945063 12:109130346-109130368 CGGTTCTGCCACTTACAAGCTGG - Intronic
1102005815 12:109588567-109588589 CAGCTCTCCCACTTGCCAGCTGG + Intronic
1102072988 12:110037139-110037161 CAGCCCTATCACTTACTGGTTGG + Intronic
1102192766 12:111001547-111001569 CAGCTCTGCCACTTGCTAGCTGG + Intergenic
1102884352 12:116510288-116510310 CATCTCTGCCACTTACTAGTGGG + Intergenic
1103360800 12:120352465-120352487 CAGCTCTGCCACTTCCTAGTTGG + Intronic
1104023596 12:125010303-125010325 CAGCTCTGCCTCTTACTAGCTGG - Intronic
1104498527 12:129263454-129263476 CAGCTCCACCTCTTACATTTGGG - Intronic
1106192366 13:27464663-27464685 CAGCTCTGCCACCTATTAGTTGG - Intergenic
1106388067 13:29307490-29307512 CAGATCCACAACTGACAAGTTGG - Intronic
1107283842 13:38767062-38767084 CAGCTCTGCCCCTTACTAGCTGG - Intronic
1108041684 13:46345259-46345281 CGGCTCTGCCACTTACCAGCAGG + Intronic
1108582662 13:51840115-51840137 CAGTTCTACCACTTACTAGCTGG - Intergenic
1109050245 13:57471240-57471262 CAGCTCTAACACTCAGAAGAAGG - Intergenic
1109714211 13:66200077-66200099 CAGCTCTGCCACTCACAAGCTGG - Intergenic
1110115766 13:71814920-71814942 CAGCACTTCAACTAACAAGTTGG + Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112820852 13:103333204-103333226 CAGCTTTTCCACTTAGTAGTTGG + Intergenic
1113136396 13:107095114-107095136 TAACTGTACCATTTACAAGTAGG + Intergenic
1117501122 14:56352373-56352395 CAGCTCCACCACTAAATAGTTGG - Intergenic
1117761999 14:59038895-59038917 GAGCACTACTACTTTCAAGTCGG + Intergenic
1118866652 14:69709662-69709684 CAGCTCAGCCATTTACCAGTGGG - Intronic
1119041206 14:71276345-71276367 CAACTCTGTCACTTACTAGTTGG - Intergenic
1119376344 14:74196900-74196922 CAGCTCTAGCACTTAGCAGCAGG - Intronic
1119420302 14:74504148-74504170 CAGCTCTGCCACTTACTAGGTGG + Intronic
1119619492 14:76121225-76121247 CCTCGCTACCACTTACAAATTGG + Intergenic
1119638587 14:76296700-76296722 CAGCTCTGCCTCTTTCAAGGTGG + Intergenic
1119761483 14:77155078-77155100 CAGGTCTGCCACCTACAAGCTGG - Intronic
1120745412 14:88147140-88147162 GAGCTCTGCCCCTTCCAAGTTGG + Intergenic
1122014696 14:98784833-98784855 TAGGTCTACCACTTGCTAGTGGG + Intergenic
1124785730 15:32678952-32678974 TAGCTCAACCACTTAAAATTTGG - Intronic
1126191083 15:45879496-45879518 AAGCTCTACTACTTACTAGCTGG - Intergenic
1126229623 15:46309787-46309809 CAGCTCTGCCAGTTACTAGCAGG - Intergenic
1127983217 15:64049281-64049303 CAGCTCAGCCACTTACAAATTGG - Intronic
1128261989 15:66239063-66239085 CAGCTCTGCCATTTAAAAGCAGG - Intronic
1129294105 15:74590324-74590346 CAGCTCTACCACTTACTGGCTGG - Intronic
1129542312 15:76360411-76360433 CAGCTCTACCAATGACGAGCTGG - Intronic
1129743810 15:78004010-78004032 CAGCTCTACCACTTACTAGCTGG + Intronic
1129767230 15:78178051-78178073 CAGCTCTGCCATTTACTAGCTGG + Intronic
1129793639 15:78359903-78359925 CAGCTCTGCCATTTACAAACTGG - Intergenic
1130283618 15:82538207-82538229 CAACTCTGCCACTTACTAGCTGG + Intronic
1130905305 15:88235842-88235864 CAGCTCTGCCACCTACCAGTTGG + Intronic
1130964588 15:88687405-88687427 CAGCTCCATCACTTACTAGCTGG + Intergenic
1131360722 15:91788390-91788412 CACATGTTCCACTTACAAGTGGG + Intergenic
1131866261 15:96713943-96713965 CAGCTCCACCAGTTACTAGATGG - Intergenic
1131961807 15:97796996-97797018 GCTCTCTACCACTTCCAAGTTGG - Intergenic
1133598976 16:7320747-7320769 AAGCTCAAACACTTACAAATGGG + Intronic
1133788610 16:8991980-8992002 CAGCTCTCCCACTTACCAGCTGG - Intergenic
1134008992 16:10837295-10837317 TAGCTCTGCCACTTACCAGTGGG - Intergenic
1134313015 16:13093302-13093324 CATCTCTGCCACTTACTAGTTGG + Intronic
1134686518 16:16162618-16162640 CAGCTCTGCCACTTACCAGCTGG - Intronic
1135056580 16:19237144-19237166 CAGCTCAACCACTCACCAGCTGG - Intronic
1135242003 16:20815707-20815729 CAGCCCTACCACTTACTAGCTGG - Intronic
1135793791 16:25422612-25422634 CTTCTCTGCCACCTACAAGTAGG - Intergenic
1135998276 16:27269465-27269487 TGGCTCTGCCACTTACTAGTTGG + Intronic
1137920118 16:52478695-52478717 CAGCTCTACCACTTACAAGCTGG + Intronic
1138162371 16:54766480-54766502 CAGCTCTGCCACTTACTAGCTGG + Intergenic
1139149464 16:64363421-64363443 CAGCTCTCACAATTACAAGAAGG + Intergenic
1141275080 16:82580061-82580083 CAGTTCTGCCACTTATGAGTTGG + Intergenic
1142478268 17:202533-202555 GAGCTCGGCCATTTACAAGTGGG - Intergenic
1142481613 17:222271-222293 CGGCTCTTCTACTTACAACTTGG - Intronic
1143340579 17:6207827-6207849 CAGCTCTGCCACTCACCAGCTGG - Intergenic
1144552210 17:16250811-16250833 CAGCTCTACCAGTTATTAGCTGG - Intronic
1144578697 17:16445838-16445860 CAGCCCCACCACTTACCAGTTGG + Intronic
1146554454 17:33811771-33811793 CAGCTGTACCACTTCCCAGCAGG - Intronic
1147991428 17:44336041-44336063 CAGCCCTACCACTCATGAGTTGG + Intergenic
1149019388 17:51945586-51945608 CAGTTCTACCACTTAACAGGGGG + Intronic
1149566943 17:57647016-57647038 TAGCTCTAACAATGACAAGTGGG - Intronic
1150433413 17:65137018-65137040 CAGCTCTGCCACTAACCAGCCGG - Intergenic
1150709289 17:67516323-67516345 CAGCTCTACTACTTACTACCTGG + Intronic
1150857505 17:68767439-68767461 CACCTCTGCCACTTACTAGCTGG - Intergenic
1151328015 17:73390771-73390793 CAGCTCTGTCACTTACCAGCAGG - Intronic
1203162991 17_GL000205v2_random:68795-68817 CAGCCCTACCACTGAAAAGGAGG + Intergenic
1153642203 18:7166763-7166785 CAGCTCTACTACTTAGCAGCTGG + Intergenic
1155186046 18:23387301-23387323 CAGCTCCACCACCTGCTAGTGGG + Intronic
1155986769 18:32238429-32238451 CAGCTCCAGCACTTACTAGCTGG - Intronic
1156357421 18:36354289-36354311 CAGCTCCACCATTTACTAGACGG + Intronic
1156540099 18:37901218-37901240 CTGCTGGACCACTCACAAGTGGG - Intergenic
1157309833 18:46544205-46544227 TAGCTCTGCCACTTACCACTGGG + Intronic
1159186563 18:64983566-64983588 GAGCCCTACCTCTTCCAAGTTGG + Intergenic
1159545004 18:69829485-69829507 CAGCTCCACTACTTACCAGCTGG - Intronic
1161896764 19:7088296-7088318 GTGCTCTACCACTTACTAGCTGG - Intergenic
1162843379 19:13372546-13372568 CAGATCTGCCACTTTCCAGTTGG + Intronic
1164806609 19:31121856-31121878 CAGCTTTACCACTTCCTAGCCGG + Intergenic
1164915723 19:32050995-32051017 CAGCTGGGCCACTTACAAATTGG + Intergenic
1165308404 19:35016109-35016131 CAGCTCTGCCACTTACTAGCTGG + Intronic
1166522845 19:43492692-43492714 CAGCTCTGCCACATACTAGCTGG + Intronic
1166591595 19:44003955-44003977 CAGCTCTACCTCTCACTAGTTGG - Intronic
1166601139 19:44095376-44095398 CAGCTCCACCTCTCACTAGTCGG - Intronic
1167231593 19:48288056-48288078 CAGCTCTGCCACATAAATGTTGG + Intergenic
1167555206 19:50190363-50190385 CAGCGATCCCACTTCCAAGTAGG - Intronic
926161667 2:10494289-10494311 CAGCTCCACCAATTCTAAGTTGG - Intergenic
926189218 2:10715274-10715296 CAGTTCTGCCACTTACTAGCTGG - Intergenic
927432476 2:23038717-23038739 CAGCTCTGCCCCTTACTAATTGG - Intergenic
927580230 2:24237113-24237135 CACCTCTACCGCTTACTAGCAGG + Intronic
928205364 2:29279838-29279860 GAGTTCTACCACTTACTAGCTGG + Intronic
928335981 2:30398606-30398628 CAACTCTGCCACTTACTAGCTGG + Intergenic
928734721 2:34274679-34274701 TAGCTCTGTCACTTACTAGTTGG - Intergenic
928864233 2:35897734-35897756 CCACTCTACAACTTACAACTTGG - Intergenic
929686122 2:44036420-44036442 TGGCTCTGCCACTTACTAGTTGG - Intergenic
929916113 2:46137213-46137235 CAACTCTGCCACTTACCAGCTGG - Intronic
930206361 2:48590239-48590261 CATCTCTACCACTTACAGGAAGG - Intronic
930540475 2:52699782-52699804 CAGCTCTGCCATTTACAAGCTGG + Intergenic
931548501 2:63415574-63415596 CAACTCTATCACTTATTAGTGGG - Intronic
932130108 2:69179693-69179715 CAGCTCTGTCACATACAAGCTGG + Intronic
932253142 2:70261742-70261764 CAGCTATACCACTTACTATGTGG - Intronic
932297070 2:70634233-70634255 CAGCTCCACCATATACAAGTTGG + Intronic
932915249 2:75850790-75850812 CAGTTCTGCCACTTACTAGCTGG + Intergenic
934570270 2:95366420-95366442 CAGCTCATCCACTCACCAGTTGG + Intronic
936536239 2:113313704-113313726 CAGCTTTGCCACTTATCAGTGGG - Intergenic
936681266 2:114775023-114775045 CATCTCTGCCACTTACTGGTTGG - Intronic
938096563 2:128467686-128467708 GAGCCCTGCCCCTTACAAGTTGG - Intergenic
938570025 2:132554379-132554401 CAGCTCTGCCACTTATTATTTGG + Intronic
938672325 2:133598069-133598091 CTGCTCTATCACTTACATGCTGG + Intergenic
938927158 2:136054678-136054700 CAGCTCTACCACTTACTAGCTGG - Intergenic
939688344 2:145227158-145227180 CAGCTCTACCACTTACTCCATGG + Intergenic
939730507 2:145778681-145778703 CAGCTTTGCCACTTACTAGCTGG - Intergenic
940070043 2:149676712-149676734 TAGCTCTGCCACTTACCAGCTGG - Intergenic
940070373 2:149679901-149679923 CATGGCTACTACTTACAAGTAGG + Intergenic
941746141 2:169088676-169088698 CAGTTCTGCCACTTACCAGCTGG - Intronic
941824778 2:169882935-169882957 CAACTCTACCACTAACTAGACGG - Intronic
943329845 2:186545955-186545977 CAGCTCTACCACTTTCTAGTTGG - Intergenic
943776957 2:191775954-191775976 CAGAGCTACCACTAACCAGTTGG + Intergenic
944468958 2:200032729-200032751 CAGTTCTACCACTTACTGGCTGG - Intergenic
944613159 2:201431807-201431829 CAGCCCCACCACTTACTGGTTGG + Intronic
945050853 2:205823055-205823077 CAGTTCTATCTCTTACATGTTGG - Intergenic
946054644 2:216889996-216890018 GAGCTCTGCCTCTTACAAATTGG - Intergenic
946113333 2:217439210-217439232 TAGCTCTACCATTTACTAGCTGG + Intronic
947750832 2:232531156-232531178 CAGCTCTGCCACTTACTAGCTGG - Intronic
1168815613 20:734557-734579 CGGTTCTACCACGTACAACTAGG + Intergenic
1168952541 20:1812282-1812304 CAGCTCTGACACTTACTAGCTGG + Intergenic
1168995865 20:2132801-2132823 CAGCTCTCCTACTTACTAGCTGG + Intronic
1172346880 20:34209230-34209252 GAGCCCTACCCCTTCCAAGTTGG + Intronic
1172437941 20:34943187-34943209 TAGCTCTACCACTCACTAGTAGG + Intronic
1172463619 20:35138407-35138429 CAGCCCTACCACCTACTAGATGG - Intronic
1172489368 20:35322790-35322812 CAGCACTGTCACTTACAAGCAGG - Intronic
1172606589 20:36218171-36218193 CAGCTCTACCACTAACTTGCTGG + Intronic
1172625340 20:36343475-36343497 CAGCTCTGCTCCTTCCAAGTTGG - Intronic
1172634726 20:36402270-36402292 CATCTCTACCACTTACCAACTGG + Intronic
1173594565 20:44250269-44250291 CAGCTCTACCACTGACCAGCTGG + Intronic
1173705394 20:45106688-45106710 CAGCTCTAGTACTTACAAGTTGG + Intergenic
1174166071 20:48584401-48584423 CAGCTCCACCACTTCCTAGCTGG + Intergenic
1175173425 20:57094994-57095016 CAGCTCCACCACTTACTAGATGG + Intergenic
1175299687 20:57934156-57934178 CACCTCTCCCACTTCCAAGAAGG - Intergenic
1175842430 20:62037755-62037777 CAGCTCCACCCCTGCCAAGTCGG + Intronic
1176338845 21:5624054-5624076 CAGCCCTACCACTGAAAAGGAGG - Intergenic
1176340253 21:5687127-5687149 CAGCCCTACCACTGAAAAGGAGG - Intergenic
1176472507 21:7119280-7119302 CAGCCCTACCACTGAAAAGGAGG - Intergenic
1176504574 21:7637329-7637351 CAGCCCTACCACTGAAAAGGAGG + Intergenic
1177789753 21:25710035-25710057 CTGTACTACCATTTACAAGTAGG - Intronic
1177789757 21:25710078-25710100 CTGTACTACCATTTACAAGTAGG - Intronic
1178639531 21:34334871-34334893 CAGCTCTACCCCTAACTTGTTGG - Intergenic
1180669773 22:17543973-17543995 CAGCTCTGCTACTTACTAGCTGG - Intronic
1181294007 22:21820309-21820331 CAGCTATACCACTTCCAATACGG + Intronic
1182150615 22:28024651-28024673 CATCTCTGCCACTGACAAGTGGG + Intronic
1182321869 22:29482853-29482875 CAGCTCTGCCACTCACTAGCTGG + Intronic
1183069673 22:35387293-35387315 CAGCACTGCCACTTACTAGCTGG + Intronic
1183104457 22:35606338-35606360 CAGCTCTGCCACTTACTAGCAGG + Intergenic
1183208755 22:36436936-36436958 CAGCACTACCACTTCCTGGTTGG + Intergenic
1184042719 22:41953466-41953488 TAGCTCTGCCACTTTCCAGTTGG + Intergenic
1184804532 22:46784921-46784943 CAGCTCCAACACTTACTAGCTGG - Intronic
1185402875 22:50627626-50627648 CAGCTCTACCACTCCCAACCTGG - Exonic
1203239517 22_KI270733v1_random:1585-1607 CAGCCCTACCACTGAAAAGGAGG - Intergenic
950126905 3:10515135-10515157 CAGCTCTGCCACTTACCACTGGG + Intronic
950638650 3:14333689-14333711 CAGCTCCACCACTTACCAGCTGG + Intergenic
952326218 3:32322786-32322808 GAGCTCTAACATTTACAATTTGG + Intronic
953266458 3:41393903-41393925 CAGCTCTACCATTTCCTAGTTGG + Intronic
953403928 3:42651081-42651103 CAACTCTGCCACTTCCCAGTTGG + Intergenic
954065176 3:48100151-48100173 CAGATCTACCACTTACTGGTTGG - Intergenic
954929479 3:54268772-54268794 CGGCTCTGCCACTTACTAGCTGG - Intronic
955002373 3:54939322-54939344 CAGCTCTGCCCCTTAGAAATTGG - Intronic
955508131 3:59652393-59652415 CAACTCTACCACTTACTATGAGG + Intergenic
955514205 3:59710522-59710544 CAGCTCTACCTCTTACAAGCTGG + Intergenic
955546036 3:60031422-60031444 CTGTTCTACCATTTACTAGTTGG - Intronic
955884421 3:63582773-63582795 CGGTTCTACCACTTACTAGCTGG + Intronic
955959235 3:64321954-64321976 CAGCTCTCTCACTGTCAAGTTGG - Intronic
956462481 3:69485574-69485596 GAGCCCTACCCCTTCCAAGTTGG - Intronic
959137608 3:102443876-102443898 AAGCACTACCACTAAAAAGTAGG - Intronic
959910979 3:111763356-111763378 CACCTCTACCACTTTCTAGCTGG + Intronic
960758133 3:121041730-121041752 CAGCTGCACCACTTTCATGTTGG - Exonic
960848351 3:122025436-122025458 CAGCTCTGCTACTTACAAGCTGG - Intergenic
960854303 3:122086955-122086977 CAGCTGTACCATTTACTAGCTGG + Intronic
961267000 3:125651446-125651468 CAGCCCTTCCACTTAGTAGTTGG - Intergenic
961405249 3:126673765-126673787 CAGCTCCACTACTCACTAGTTGG + Intergenic
961671619 3:128536166-128536188 AGGCTCTGCCACTTACTAGTTGG - Intergenic
962611491 3:137080969-137080991 CAGCTCTACCACTTTCCAATTGG - Intergenic
963123740 3:141797033-141797055 CAGCTCTACCAGTTATAAGCCGG - Intronic
963781937 3:149495206-149495228 CAGCTGTACCAATTTCCAGTTGG + Intronic
964348579 3:155780358-155780380 CAGCTCTGCCATTTACTAGCTGG + Intronic
964420323 3:156495621-156495643 CAGCTCCATCACTTACTAGCTGG + Intronic
964673488 3:159252361-159252383 CTTCTCTACAACTTACTAGTTGG + Intronic
966569306 3:181423376-181423398 CAGCTCTACCACTTACTAGCTGG + Intergenic
966846485 3:184134696-184134718 CAGTTCTTCCACTTACTAGCTGG + Intergenic
967642646 3:191884712-191884734 CAAACCTACCAATTACAAGTTGG - Intergenic
968543458 4:1181030-1181052 AAGCTCAACCAATTCCAAGTAGG + Intronic
968596741 4:1489776-1489798 CAGCTCTACCACCTGGAAGGTGG + Intergenic
969110769 4:4842833-4842855 CAGCGCTACCACTTATGAGCTGG + Intergenic
969517938 4:7658884-7658906 CATCTCAACCACTTGCAAGCAGG + Intronic
969604393 4:8195265-8195287 CAACTCTACCATTTGCAAGATGG + Intronic
970156854 4:13150531-13150553 CAGCTTTGCCACCTAGAAGTTGG + Intergenic
970356388 4:15257525-15257547 CAGCTCAGCCACTTAACAGTGGG + Intergenic
970858514 4:20675565-20675587 CAGCTCTGCCACTTCCTAGCTGG + Intergenic
971334846 4:25712811-25712833 CAGCTCCTCCACTTACACGCAGG - Intergenic
972096874 4:35358801-35358823 CTGCTCTACCTCTTATGAGTTGG + Intergenic
972678163 4:41280152-41280174 CAGCTCCACCCCTTACCAGCTGG + Intergenic
975102057 4:70524955-70524977 CAGCTGTTCAACTTACATGTGGG - Exonic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
976107623 4:81636024-81636046 CATCTCAGCCACTTACAAGGTGG + Intronic
976545741 4:86333699-86333721 CAGCTCTACCATATACTGGTTGG + Intronic
977267993 4:94879171-94879193 CAGCTCTACCATTTACTTGCTGG - Intronic
977434811 4:96980511-96980533 TATTTCTACCACTTACAATTAGG - Intergenic
977857464 4:101911122-101911144 CAGCTCTGCCACTTACCATCTGG - Intronic
978427663 4:108598750-108598772 CAGCTCTGCCACTTAACAGAGGG + Intergenic
978460744 4:108949447-108949469 TGGCTCTGCCACTTACAATTGGG - Intronic
979352768 4:119664730-119664752 CTGCTCTGCCACTTACCAGGTGG - Intergenic
980203021 4:129679748-129679770 CAGTTCTGCCACTTAAAAGTTGG - Intergenic
982302170 4:153891176-153891198 CAGCTCTACCTCTTAGAAAAGGG + Intergenic
982553796 4:156835710-156835732 CAGTTCTATCACTTACTACTAGG - Intronic
984393144 4:179164695-179164717 CAGCTCTGCCACTTAAAGCTGGG + Intergenic
987641660 5:20619893-20619915 CATCTCTACCACTGTCAAATGGG + Intergenic
988247335 5:28703766-28703788 CAGTTTTACCACTTAGAACTGGG + Intergenic
988650089 5:33139565-33139587 CAGCTCTACAACTTACTACCTGG + Intergenic
988789000 5:34590192-34590214 CAGCTCCACCACTTACTTGGTGG - Intergenic
990235416 5:53762074-53762096 CAACTCTATGACTTACAGGTGGG + Intergenic
990490548 5:56298967-56298989 CAGATTTTCCACTTACAAGCTGG + Intergenic
992022978 5:72643204-72643226 CAGCTCCACCACTTCCATGAAGG + Intergenic
992025461 5:72665033-72665055 CAGCTCTGCCACTTTCTAGCTGG - Intergenic
993103745 5:83574346-83574368 CAGGTCTACCCCTTGCAACTTGG + Intronic
994150401 5:96440979-96441001 CAGCTCTGCCACTTATTAGCTGG + Intergenic
998481719 5:142468595-142468617 CAGCTCTGCCACTTACTATGTGG - Intergenic
998561752 5:143178799-143178821 TAGGTCAACCACTTACAAGCTGG - Intronic
999255729 5:150209195-150209217 CTGTTCTACCACTTGCAAGCTGG - Intronic
999420389 5:151436869-151436891 CAGCCCTGCCACTTACTAGCAGG - Intergenic
999580389 5:153031930-153031952 TAACTCTACCACTTACTAGCTGG - Intergenic
999814962 5:155166788-155166810 CAGCTCTCCCACTTACGGATCGG + Intergenic
1000766405 5:165296339-165296361 CTGCTCTGCCACTTAAGAGTCGG - Intergenic
1000824170 5:166023497-166023519 CAGCTCTACCAATTACCAGCTGG - Intergenic
1000967476 5:167675653-167675675 CAGCTCTGCTACTTAAAATTTGG + Intronic
1000996613 5:167965809-167965831 CAGCTCTGTCACTTACTAATGGG - Intronic
1001399867 5:171440056-171440078 CGGCTCCACCACTTTCGAGTGGG + Intronic
1001698177 5:173688152-173688174 CAGCTCTCCTACTTACTAGCTGG - Intergenic
1001826480 5:174749610-174749632 CATCTCCACTACTTACTAGTTGG - Intergenic
1001924033 5:175623184-175623206 CAGCTCTGCCATTTGCTAGTTGG + Intergenic
1002884126 6:1278832-1278854 CAGCTCTGCCACTTGCAAGCTGG - Intergenic
1004454620 6:15780537-15780559 CAGCTCTGCTACTTACCAGCTGG - Intergenic
1006101987 6:31691179-31691201 CAGCTCTACCACTTACTGTGAGG + Intronic
1006192609 6:32218849-32218871 CAGCTCTGCCACTTGCTAGCTGG + Intronic
1006366353 6:33618421-33618443 CAGCTCTGCCACTTTCTAGCAGG - Intergenic
1006635880 6:35460815-35460837 CAGCTCCACCTCTTACCAGCTGG + Intronic
1007405558 6:41634206-41634228 CAGCTCCACCCATTACTAGTGGG + Intergenic
1007462513 6:42028677-42028699 CAGCTCTAGCACTTAGGAGCGGG + Intronic
1007491609 6:42227575-42227597 CAGCTCTGCCACCCACAACTTGG + Exonic
1007660330 6:43480920-43480942 CAGCTCTGTCACTTACTAGCTGG - Intronic
1008886277 6:56433666-56433688 CAGCTGTAGCACTTACTAGCTGG + Intergenic
1009818839 6:68773251-68773273 TGGCTCTGCCACTTACAAATTGG - Intronic
1009942978 6:70310649-70310671 CAGCTCTACCACTTTCTAGCTGG + Intergenic
1011071797 6:83393115-83393137 CAGGTCCACCACTGACATGTTGG - Intronic
1011686933 6:89830816-89830838 CAGCTCTGCCACTTACCAGGTGG + Intronic
1012964036 6:105653847-105653869 CAGTTCTAGCACTTACATTTAGG + Intergenic
1014619389 6:123646811-123646833 CAACTATCCCACATACAAGTAGG + Intergenic
1014764644 6:125392606-125392628 CATCTCTGCCATTTACTAGTTGG - Intergenic
1015236248 6:130974618-130974640 TGGCTCTACCACTCATAAGTGGG - Intronic
1016041405 6:139435245-139435267 CAGTTGTACCACTTACCAGCTGG + Intergenic
1016083246 6:139881053-139881075 CAGCTGTACCATTTAGAAGAAGG - Intergenic
1018299863 6:162389737-162389759 CAGCTTTACCACTTATTAGAAGG - Intronic
1019263201 7:93927-93949 CAGCTCAGCCACTTAAAAGTAGG + Intergenic
1019898048 7:3998205-3998227 AAGCTCTGCCCCTTACGAGTTGG - Intronic
1021209218 7:17824653-17824675 CAGCTCTGCCAGTTAATAGTTGG - Intronic
1022032599 7:26505917-26505939 TGGCTCTACCACTTACAGGCTGG + Intergenic
1022694509 7:32691186-32691208 CTGCTCTACCATTTACTAGCTGG - Intergenic
1022927689 7:35072698-35072720 CTGCTCTACCATTTACTAGCTGG - Intergenic
1024097098 7:45990923-45990945 CAGCTCTACCACTTTGGAGAGGG + Intergenic
1024568578 7:50705250-50705272 CACATCTACCACTTAGAAGGAGG + Intronic
1028374582 7:90132886-90132908 CTGCTCTACCATTTACTAGCTGG + Intergenic
1028483490 7:91333533-91333555 CATCTCATGCACTTACAAGTAGG - Intergenic
1028912477 7:96224154-96224176 CAGCTCTTCCACTCACAAAGTGG + Intronic
1029106036 7:98176897-98176919 CAGCACTACCACTTAAGAGTTGG - Intronic
1030645962 7:112062046-112062068 CTGCTCTGCCACTTACTAGCTGG - Intronic
1031083301 7:117278648-117278670 CAGCTCTCCCACTTCTGAGTTGG + Intronic
1031943355 7:127813198-127813220 CATTACTACCACTTCCAAGTGGG - Intronic
1031958077 7:127962832-127962854 CAGCTCTACAACTTGCAATCAGG + Intronic
1032739973 7:134729350-134729372 CAGCTCCACCATTTACTAGCTGG - Intergenic
1032868472 7:135954045-135954067 CAACTCTACCACTTAGTTGTGGG + Intronic
1034198475 7:149265888-149265910 CAGCTCTGCCACTTACAAGCTGG - Intronic
1034696065 7:153054956-153054978 CAGCTCTTCCAATTACCAGTTGG - Intergenic
1036063880 8:5356606-5356628 CAGCTCCACCCCTTACTAGCTGG + Intergenic
1038047396 8:23777253-23777275 CAGCTCTGCCACTCATGAGTGGG + Intergenic
1039097568 8:33903257-33903279 CAGCTCTTCCACTTACTACCTGG - Intergenic
1039697185 8:39925580-39925602 CAGCTCTGCCACTTTCTAGCTGG - Intronic
1040072009 8:43196104-43196126 CAGCTCTGCCACTTCCCAGCTGG + Intronic
1041313687 8:56540605-56540627 CATCTCTGCCACTTCCAAGTCGG - Intergenic
1041492080 8:58444196-58444218 CAGCTCTCTCACTTACCAATAGG + Intronic
1042485939 8:69345718-69345740 CATCTCTACCACTTTCATTTTGG - Intergenic
1044300916 8:90581928-90581950 CAGCTCTGCCACTCACCAGCTGG + Intergenic
1044305092 8:90630471-90630493 TGGCTCTACCACTTATTAGTCGG + Intronic
1044463643 8:92478533-92478555 CAGTTCTGCCACTTACAACTTGG - Intergenic
1044612011 8:94100919-94100941 CAGCTCCACCACTTACTAGCTGG - Intergenic
1044952463 8:97447643-97447665 CCGCTCTACCACTAACCAGTGGG + Intergenic
1045418676 8:101992548-101992570 CAGCTTTGCCACTTACCAGCTGG + Intronic
1045548414 8:103149067-103149089 TAGCTCTCCCACTTCCAAGCTGG - Intronic
1045618179 8:103941816-103941838 CACCTCTTTCACTTACAAGCTGG + Intronic
1045640165 8:104241020-104241042 CCACTCTACCATTTACAAGGTGG - Intronic
1046740274 8:117820279-117820301 CAGATCTACCACTTACTGGTCGG + Intronic
1053295079 9:36906928-36906950 CAGCTCTGCCACTTATGAATTGG - Intronic
1055120011 9:72648885-72648907 CAGTTTTAGCACTTACCAGTTGG - Intronic
1055730663 9:79276751-79276773 CAGCTTCACCACTTACTAGCAGG - Intergenic
1056062236 9:82895690-82895712 CTGCTCTCCAACTTACATGTTGG + Intergenic
1056480160 9:86995104-86995126 TAGCTCTGGCACTTAGAAGTTGG + Intergenic
1057602913 9:96473906-96473928 CAGCTCTGCCACTTACTAGTTGG + Intronic
1058385921 9:104435777-104435799 CATCTCTATCACTTACATGTTGG + Intergenic
1058645700 9:107129897-107129919 CGGCTCTGCCACTTAATAGTTGG - Intergenic
1059339591 9:113590153-113590175 CAGCTCTGTCACTTACATGCTGG + Intronic
1059395917 9:114033990-114034012 CAGCTCCACCACTTACTAGCTGG + Intronic
1059588210 9:115629046-115629068 CACCTCTACCACTTACTAACTGG + Intergenic
1060018783 9:120110596-120110618 CAGCTTTCCCACTTACAAAATGG + Intergenic
1060514331 9:124256669-124256691 CAGCTCAACCACTTACCATCTGG + Intergenic
1060545942 9:124458993-124459015 CAGCTCTGCCACTTACAAGCTGG - Intronic
1060689859 9:125648188-125648210 CAGCTCTGCCACACACTAGTGGG + Intronic
1061048408 9:128179992-128180014 TGGCTCTACCACTTACAGGCTGG + Intronic
1061360789 9:130141037-130141059 CAGCTCTGACACTTACTAGCTGG - Intergenic
1203422814 Un_GL000195v1:10866-10888 CAGCCCTACCACTGAAAAGGAGG + Intergenic
1186840187 X:13477710-13477732 CAGCTCTACCACTCACTGGCTGG - Intergenic
1187368961 X:18688052-18688074 CAGCTCTGCCACTTTCAACCTGG - Intronic
1187526883 X:20062268-20062290 CAGCTCTACCACTGAGCAGCTGG - Intronic
1187660524 X:21541818-21541840 TAGCTCTATCACTTACTAGTTGG - Intronic
1189586608 X:42468317-42468339 CTGCTCTACCACTTATCAGCTGG - Intergenic
1189947389 X:46193189-46193211 CAGCTCTGCCATTTGCTAGTTGG + Intergenic
1192226249 X:69230073-69230095 TAACTCTACCACTTACTAGCTGG - Intergenic
1192331198 X:70176803-70176825 CAGCTCTGTCACTTACAAGGTGG - Intergenic
1193298978 X:79866677-79866699 CAGCTCTAACAGTTACTTGTTGG + Intergenic
1195021043 X:100828970-100828992 TAGCTCTGCCACTTACTAGTTGG - Intronic
1195666876 X:107439837-107439859 CAACTCTGCCACTTACCAGTAGG + Intergenic
1196889410 X:120277660-120277682 CAGTTCTACCACTTACGACTTGG - Intronic
1197291152 X:124659994-124660016 CAGCTTTAGCCCTTACATGTAGG - Intronic
1198729709 X:139716379-139716401 GGACTCTGCCACTTACAAGTAGG - Intergenic
1198742811 X:139858759-139858781 CAGCTCTATCACTTAGTAGCTGG - Intronic