ID: 1092050724

View in Genome Browser
Species Human (GRCh38)
Location 12:5467994-5468016
Sequence CATCAGAGGGAAAATGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 447}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092050724_1092050731 -6 Left 1092050724 12:5467994-5468016 CCCCCCACATTTTCCCTCTGATG 0: 1
1: 0
2: 2
3: 41
4: 447
Right 1092050731 12:5468011-5468033 CTGATGAGATTTCCTCTCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 186
1092050724_1092050733 5 Left 1092050724 12:5467994-5468016 CCCCCCACATTTTCCCTCTGATG 0: 1
1: 0
2: 2
3: 41
4: 447
Right 1092050733 12:5468022-5468044 TCCTCTCTGAGGGAATATTTTGG 0: 1
1: 0
2: 0
3: 14
4: 224
1092050724_1092050732 -5 Left 1092050724 12:5467994-5468016 CCCCCCACATTTTCCCTCTGATG 0: 1
1: 0
2: 2
3: 41
4: 447
Right 1092050732 12:5468012-5468034 TGATGAGATTTCCTCTCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092050724 Original CRISPR CATCAGAGGGAAAATGTGGG GGG (reversed) Intronic
900093434 1:930430-930452 CATCTGAGGGAAGGTGTGGGAGG - Intronic
900591323 1:3461514-3461536 CAGCAGAGGGGAAAGCTGGGAGG + Intronic
900706929 1:4086825-4086847 TGTAAAAGGGAAAATGTGGGAGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901451682 1:9339931-9339953 CATCAGAAGGAAAAGGTGGAGGG - Intronic
902125830 1:14210143-14210165 CATGAGAGGGACACAGTGGGAGG + Intergenic
902134756 1:14295380-14295402 CATGAGAGGGAGAAGCTGGGAGG - Intergenic
902184196 1:14712846-14712868 AAGCACAGGGAAAAGGTGGGGGG - Intronic
902503000 1:16922831-16922853 GAGAAGAGGTAAAATGTGGGTGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903662858 1:24989321-24989343 CAGCAGAGGGGAAGGGTGGGAGG + Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904102158 1:28040585-28040607 CATCAAAGGAGAAAGGTGGGAGG + Intronic
904328773 1:29744756-29744778 GATCTGGGGGAAAATGTGGGAGG + Intergenic
904431451 1:30467188-30467210 CAACAGAGGCAAAATGGGGCAGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905737476 1:40339786-40339808 AATCAGATGGAACAAGTGGGAGG - Intergenic
905857586 1:41324180-41324202 CATTTGGGGGAAAATTTGGGAGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906678121 1:47708088-47708110 CCTCAGACGCAAAATGTAGGGGG - Intergenic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908702717 1:66919925-66919947 TATCAGTGGGAAGATGTAGGGGG - Intronic
909056537 1:70827408-70827430 CATAATAGGATAAATGTGGGTGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910514290 1:88040827-88040849 CATGACAGGAAAAATATGGGGGG + Intergenic
911514738 1:98853809-98853831 CAGCAGAGGGAAAATGTTCTTGG - Intergenic
912430859 1:109627681-109627703 GATCAGAGGGAGCAGGTGGGAGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915894743 1:159803044-159803066 CAACAGAGAGAAGATGTAGGCGG - Intronic
916088076 1:161285635-161285657 CAACACAGAGACAATGTGGGTGG - Intergenic
916312850 1:163416252-163416274 CATAAGAGGGTTAATGTGGCTGG - Intergenic
917071174 1:171152416-171152438 CATAATAGGGGAAATTTGGGGGG + Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
918808789 1:189087585-189087607 CATGAGAGGGACCTTGTGGGAGG + Intergenic
919323031 1:196067036-196067058 CAACAGAAGGAAAATTTTGGTGG - Intergenic
919510193 1:198453538-198453560 CATTAGAGAGAGAATGTGGAAGG - Intergenic
921568312 1:216747880-216747902 CATTATAGGCAAAATGAGGGAGG - Intronic
922069971 1:222182556-222182578 CATGGGAGGGAAATGGTGGGAGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923032751 1:230263070-230263092 CAGCAGAGGGGAAATGGAGGTGG + Intronic
923427687 1:233888456-233888478 CATGAGAGGGACCAGGTGGGAGG + Intergenic
923545925 1:234923254-234923276 CCTCTCAGGGAAAAGGTGGGGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063268466 10:4480035-4480057 CATCAGAGAGGAAAGGAGGGAGG - Intergenic
1063889390 10:10614213-10614235 TACCAAAGGGAAAATGGGGGAGG - Intergenic
1063922450 10:10945898-10945920 CAGCAGGGGGAAAACGTGGGAGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065408158 10:25391204-25391226 GTGCAGAAGGAAAATGTGGGTGG + Intronic
1067533654 10:47092612-47092634 CATCAGAGGGCCACTGAGGGAGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072689643 10:97563568-97563590 CATCAGAGTGAAAGTATTGGAGG + Intronic
1074256770 10:111810872-111810894 CAAGAGAAGGAAAAAGTGGGTGG + Intergenic
1074451636 10:113564258-113564280 CATAGGAGGGACCATGTGGGAGG - Intronic
1075168456 10:120091165-120091187 CCCCAAAGGGCAAATGTGGGAGG + Intergenic
1075581729 10:123623884-123623906 CATGAGAGGGTAAGGGTGGGGGG + Intergenic
1075709858 10:124525227-124525249 CCTCAGAGGGAACATCTGGGTGG + Intronic
1077342179 11:2031041-2031063 CAGCTGGGGGGAAATGTGGGTGG + Intergenic
1077919861 11:6633798-6633820 CATCCAAGGTAAAAAGTGGGGGG + Exonic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078495755 11:11814748-11814770 CAGAAAGGGGAAAATGTGGGAGG + Intergenic
1079391851 11:20028701-20028723 CATCCGGGGGAAAATGGGGGTGG + Intronic
1079777666 11:24554009-24554031 CAGCAGAGAGAAAATGTGCCAGG - Intronic
1081361833 11:42189739-42189761 CCTCAGTTGGAAAATGTGGTAGG + Intergenic
1081371388 11:42308599-42308621 CTTCAGAGGGAAATTGTGAGAGG - Intergenic
1082570967 11:54739728-54739750 CATGAGAGGGACGAGGTGGGAGG + Intergenic
1085196717 11:74677087-74677109 CTTCAGCTGGAAAATGGGGGTGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085620253 11:78032502-78032524 CATCACCTGGAAAATGGGGGTGG - Intronic
1085720171 11:78905582-78905604 CCTCGGAGGAAAAATGTGGCTGG - Intronic
1085906421 11:80769622-80769644 CATGGGAGGGACACTGTGGGAGG + Intergenic
1086538934 11:87884590-87884612 CAACAGAGAGATAATTTGGGAGG + Intergenic
1086921870 11:92596490-92596512 CATCAAAGGGAGAATGGTGGTGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1089840347 11:121412180-121412202 TATATGAGGGAAAATGTAGGAGG - Intergenic
1090735578 11:129609932-129609954 CATCACAGTTAAAGTGTGGGTGG + Intergenic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1202825165 11_KI270721v1_random:86230-86252 CAGCTGGGGGGAAATGTGGGTGG + Intergenic
1091807684 12:3367455-3367477 CATGAGAGAAACAATGTGGGAGG + Intergenic
1092050724 12:5467994-5468016 CATCAGAGGGAAAATGTGGGGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092641228 12:10512765-10512787 CATTGGAGGGAAAATGTTAGAGG - Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093624366 12:21327970-21327992 CATGGGAGGGAACTTGTGGGAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094179044 12:27571433-27571455 AATGAGAGGGAAAATGGGGGAGG + Intronic
1094352243 12:29540069-29540091 CATCATAGGAAAAATATGGTAGG + Intronic
1095536649 12:43256826-43256848 CCTCAGAAAGAAAATGTGAGGGG - Intergenic
1095701982 12:45200136-45200158 CAACAGAGGGAAAGAGTGGGAGG - Intergenic
1097338469 12:58410878-58410900 CATAAAAGGAAAAATCTGGGAGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099881438 12:88471809-88471831 AATCATAGGGATTATGTGGGAGG - Intergenic
1100013051 12:89976688-89976710 CAACAGAGGGTAAATGTGAGGGG + Intergenic
1101398915 12:104371692-104371714 CCTCAGCTGGAAAATGGGGGTGG + Intergenic
1101555718 12:105807243-105807265 CATGAGAAGGACAATGAGGGAGG - Intergenic
1101699500 12:107158873-107158895 CATCTGAGAGAAAAGGAGGGGGG + Intergenic
1102013117 12:109631179-109631201 CATCAGCTGGAAAATGAGCGAGG - Intergenic
1102628464 12:114255462-114255484 CAGGAGAGGGAATATGTGGGAGG + Intergenic
1103844460 12:123891836-123891858 CAGCAGAGGGAAAAAGTGCATGG + Intronic
1104253118 12:127115402-127115424 GATGAGAGGGGCAATGTGGGTGG - Intergenic
1105806675 13:23955495-23955517 CAGGAGAGGGAAAAAGTGGGTGG + Intergenic
1106340704 13:28823985-28824007 CATGAGAGGGACTAGGTGGGAGG - Intronic
1106475536 13:30095096-30095118 CATGGGAGGGACACTGTGGGAGG + Intergenic
1107417780 13:40217349-40217371 CAAGAGAGAGAAAATGGGGGAGG - Intergenic
1107439342 13:40410672-40410694 GATCACAGGGAAGATGTGAGTGG + Intergenic
1108317391 13:49250010-49250032 AAACAGAGGTAAAATGAGGGGGG + Intronic
1109779320 13:67086572-67086594 CATCAGAAGTAAAATTTGGATGG + Intronic
1111192625 13:84830507-84830529 GATCAGATAGTAAATGTGGGTGG + Intergenic
1111627524 13:90808307-90808329 CATGAGAGGGAACTGGTGGGAGG - Intergenic
1111824607 13:93251739-93251761 CAACAGGGAGAAAATGTAGGAGG + Intronic
1111919785 13:94397876-94397898 CATGAGAGGGAACTGGTGGGAGG + Intronic
1112339526 13:98541507-98541529 CATCAGAGCCAGAAAGTGGGAGG + Intronic
1112670019 13:101624730-101624752 CAACAAAGGGAATCTGTGGGTGG - Intronic
1112709250 13:102108295-102108317 AATAAGTAGGAAAATGTGGGTGG - Intronic
1113458728 13:110467134-110467156 CAGCAGTGTGAAGATGTGGGAGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114927353 14:27421066-27421088 CATGGGAGGGAAATTGTGGGAGG - Intergenic
1115027978 14:28765627-28765649 CATTGGAGGGAAAATAAGGGTGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1117523901 14:56578492-56578514 CATCAGAGAGAACAAGTGAGAGG + Intronic
1118047785 14:61990734-61990756 CATCAGATAGAAAATGGGGTTGG + Intergenic
1118367410 14:65107814-65107836 CAGGAAAGGGAAAATATGGGAGG + Intergenic
1118461943 14:65995452-65995474 AATAAGAGGGAACATGAGGGTGG - Intronic
1118992046 14:70806223-70806245 CATCAGAGGGTGAACATGGGCGG - Intronic
1119431827 14:74573418-74573440 CATCAGTGGGGAACTGTGGCAGG + Intronic
1119799127 14:77427047-77427069 CAGCAGAGGGAAAATGGCTGAGG + Exonic
1119917310 14:78413887-78413909 CATGAGAGGGACCCTGTGGGAGG + Intronic
1121192721 14:92044345-92044367 CATCAGAGTGAAAATATTGGAGG + Exonic
1121242804 14:92442095-92442117 CATCTGAGCGAAGATGTGGCTGG + Exonic
1121262725 14:92578316-92578338 CTTCAGTGGGAAAATGTTTGGGG + Intronic
1121666375 14:95675519-95675541 CAGCAGAGGGAAGATGCAGGTGG + Intergenic
1122074093 14:99224611-99224633 AATCAGAGGGAAAAGGCCGGTGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123667303 15:22617655-22617677 CATCAGAGGGGATCTGTGGCTGG + Intergenic
1124321145 15:28712222-28712244 CATCAGAGGGGATCTGTGGCTGG + Intronic
1124481352 15:30083132-30083154 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124487807 15:30135228-30135250 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124522242 15:30414061-30414083 CATCAGAGGGGATCTGTGGCTGG + Intronic
1124536423 15:30552157-30552179 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124542897 15:30604205-30604227 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124562858 15:30791651-30791673 CATCAGAGGGGATCTGTGGCTGG - Intergenic
1124755721 15:32403093-32403115 CATCAGAGGGGATCTGTGGCTGG + Intronic
1124762228 15:32455435-32455457 CATCAGAGGGGATCTGTGGCTGG + Intronic
1124776401 15:32593633-32593655 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124961930 15:34404992-34405014 CATTAGTGGGAAAAAGTTGGAGG - Intronic
1124978553 15:34551213-34551235 CATTAGTGGGAAAAAGTTGGAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126745933 15:51826659-51826681 TATCAGAGAGAATATGTGGTAGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1129339152 15:74873486-74873508 CAGCAGAGCGAAGATGTGGACGG - Intergenic
1131424395 15:92333868-92333890 CATCAGAGGGGACATATGGGTGG - Intergenic
1132918778 16:2371008-2371030 CCTCAGAGGGAAGAAGTAGGAGG + Intergenic
1133557562 16:6919933-6919955 ACTCAGAGGGGAAAAGTGGGAGG - Intronic
1134374108 16:13654180-13654202 CATCAGAGGGATGAAGTGGGAGG + Intergenic
1134569287 16:15277841-15277863 CATCGGAGGGACATGGTGGGAGG - Intergenic
1134733090 16:16478204-16478226 CATCGGAGGGACATGGTGGGAGG + Intergenic
1134934349 16:18233769-18233791 CATCGGAGGGACATGGTGGGAGG - Intergenic
1135079389 16:19421326-19421348 CATGAGAGGGACGCTGTGGGAGG + Intronic
1135105366 16:19645137-19645159 CTTAAGAGGAAAAAGGTGGGGGG + Intronic
1135494486 16:22939679-22939701 CAGAAGAGTGAGAATGTGGGAGG + Intergenic
1135494597 16:22940291-22940313 CAGAAGAGTGAGAATGTGGGAGG + Intergenic
1135513006 16:23104247-23104269 CATTAGAAGGAAAATGTGCCAGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137768282 16:50994680-50994702 ACTCAGATGGAAGATGTGGGAGG + Intergenic
1137784566 16:51127506-51127528 CATGAGAGGGAAAAAGAAGGAGG + Intergenic
1138542761 16:57698441-57698463 CTTTAGAAGGAAAAGGTGGGAGG + Intronic
1138897033 16:61219046-61219068 TTTCAGAGGGAAAATTTGGATGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139789891 16:69424985-69425007 CCTCAGAGGGAAACTGGGGTGGG + Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140058943 16:71550516-71550538 CATCAGAGGGACTATGTGCATGG + Intronic
1140991683 16:80219193-80219215 CATGAGAGGGACTCTGTGGGAGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144249542 17:13401670-13401692 CATCAAGACGAAAATGTGGGTGG - Intergenic
1144887117 17:18470884-18470906 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1145145099 17:20473411-20473433 CATCAGAGGGAGGGTGCGGGAGG - Intergenic
1145725582 17:27119537-27119559 AATCAGAGGAGAAATGGGGGAGG + Intergenic
1146030447 17:29361689-29361711 CAGAAAAGGGGAAATGTGGGGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146353836 17:32117959-32117981 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147316620 17:39623953-39623975 CTTTGGAGGGAAAATCTGGGAGG - Intergenic
1149500456 17:57148361-57148383 CAGCTGAGGAAAAATGTGGCTGG + Intergenic
1150900281 17:69267322-69267344 CAGCAGAGTGAAAAAGTGGGAGG + Intronic
1151920091 17:77148164-77148186 CTTCAAAGGGAAAATGAAGGAGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152276654 17:79362063-79362085 CATCAAAGCGCAAATGTGGTGGG + Intronic
1152818669 17:82424386-82424408 GAACAGAGGAAAAATCTGGGGGG - Exonic
1153797290 18:8635608-8635630 CAGCAGGGGGAAAAGGTGAGAGG + Exonic
1155079217 18:22391226-22391248 CATCACTGGGAGAATGTGGATGG - Intergenic
1155361754 18:25010143-25010165 ACTCAGAGGGAAAGGGTGGGAGG + Intergenic
1156029852 18:32700088-32700110 CCTTAGATGTAAAATGTGGGAGG - Intronic
1157308070 18:46531406-46531428 GATGAGGGGGAAAATGAGGGGGG - Intronic
1157702236 18:49769021-49769043 CTTCAGAGGGACAAAGTTGGAGG - Intergenic
1157788570 18:50509044-50509066 CAACAGAGGAGAAATGGGGGAGG - Intergenic
1158181277 18:54717188-54717210 CATGATGGGGAAAAGGTGGGGGG + Intergenic
1158894310 18:61898705-61898727 CATCAGAGGGAACAAGTGGGGGG + Intergenic
1158941747 18:62411241-62411263 CATGGGAGGGAACAAGTGGGAGG + Intergenic
1159895849 18:73995448-73995470 CATCAGAGGGACCTAGTGGGAGG + Intergenic
1161831069 19:6604878-6604900 TATCAGCGGGGAAATGTAGGGGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1164475454 19:28572511-28572533 TATCAGAGGGAAAATGGGAGAGG - Intergenic
1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG + Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166536664 19:43578933-43578955 AAAGAGAAGGAAAATGTGGGAGG + Intronic
1167575409 19:50315395-50315417 CACCTGAGGCAAAAGGTGGGGGG + Intronic
1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG + Intronic
1167836816 19:52079620-52079642 CAGCAAAGAGAAAAGGTGGGAGG + Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168543771 19:57233401-57233423 CCTCAGACGGAAATTGTGGCAGG + Intronic
1168580107 19:57548170-57548192 CATTAAAGGGAAAATCTGGAGGG + Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925572065 2:5323070-5323092 CATGAGAGGGAAAATGTGCACGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
926066447 2:9843881-9843903 CATTAAAGGGAACTTGTGGGTGG - Intronic
926780039 2:16462119-16462141 CCTCTGGGGGAAAATGTGGAAGG - Intergenic
927810985 2:26180039-26180061 CAACAGAGGAAAAATGTGGAGGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929309045 2:40400665-40400687 CTTCAGAGGGAAAATGAGGTGGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931835816 2:66097524-66097546 CATGAGAGGGACCTTGTGGGGGG - Intergenic
934294771 2:91733566-91733588 CATTATAGGGAAATGGTGGGGGG + Intergenic
935155275 2:100478982-100479004 CATCCAAGGGAAAAGGTGGAGGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935646005 2:105335306-105335328 CATCAAAGGAAAAAAGTGGCAGG - Intergenic
936025795 2:109030271-109030293 CTTCAGTGGGAAAATGTTGAAGG - Intergenic
936148448 2:109997184-109997206 GTCCAGAGGGAAAAAGTGGGTGG - Intergenic
936196229 2:110374184-110374206 GTCCAGAGGGAAAAAGTGGGTGG + Intergenic
936909582 2:117576318-117576340 CATGGGAGGGAACCTGTGGGAGG - Intergenic
937031688 2:118746048-118746070 CATGAGAGGGACACAGTGGGAGG - Intergenic
937111958 2:119373341-119373363 CATGAGAGGGAACATGGTGGAGG - Intergenic
937341660 2:121095306-121095328 GAGCAGAGGGGAAATGTGGTAGG + Intergenic
937463613 2:122110437-122110459 CATCCAAGGGAAGATCTGGGGGG + Intergenic
937936319 2:127248412-127248434 GATCAGATGGAGAAAGTGGGAGG + Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939035811 2:137129915-137129937 CATTAGTGGGAAAATGTAGAAGG + Intronic
939106261 2:137952104-137952126 GATCATAGGGAAAGTGTGTGTGG - Intergenic
940621584 2:156120513-156120535 CATGAGAGGGACCCTGTGGGAGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941405134 2:165078172-165078194 CAACAGTGTGAAAATTTGGGTGG - Intergenic
941849243 2:170162568-170162590 CATCACAGGGAAAAGGGGAGTGG - Intergenic
941876274 2:170436777-170436799 CTTCAAAGGTAAAAAGTGGGAGG + Intronic
942504934 2:176631855-176631877 TATCAGAAGGAAAATATGGATGG + Intergenic
942950317 2:181713769-181713791 CATTAGAGGGACCCTGTGGGAGG + Intergenic
943041149 2:182807140-182807162 TATGAGAGGGAGAATGAGGGGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944840837 2:203622084-203622106 CAACAGAGGGAAAATCTTTGGGG + Intergenic
945073697 2:206015977-206015999 GTGCAGAAGGAAAATGTGGGTGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946698277 2:222383963-222383985 CATCAGAAGGACACTGTGGTAGG - Intergenic
947602518 2:231463495-231463517 CCTGGGAGGAAAAATGTGGGCGG - Intronic
948310345 2:236981053-236981075 CAGCAGAGAGAAAATGGGAGAGG - Intergenic
948450435 2:238067018-238067040 CATCAGAGGGACCCGGTGGGAGG - Intronic
948647513 2:239416441-239416463 CAACACATGGAAATTGTGGGCGG - Intergenic
948702364 2:239768418-239768440 CATCAGTGGGAAGAGGTGGGAGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169639266 20:7731651-7731673 CATGAGAGGGACCAAGTGGGAGG - Intergenic
1169785603 20:9356338-9356360 CATAAGAGGAAACATGTTGGTGG + Intronic
1170715518 20:18827895-18827917 CATCATGGGGAAAATGTGCCCGG - Intronic
1172856497 20:38007780-38007802 TATCAGAGAGCAAATGTGTGAGG + Intronic
1172896623 20:38304726-38304748 GGTCAGAGGGAGAGTGTGGGAGG + Intronic
1173844575 20:46179832-46179854 CAGCACAGGGAAGATGGGGGCGG - Intronic
1173876648 20:46376481-46376503 CATCAGAGGGACAAAGGAGGAGG - Intronic
1174361574 20:50032070-50032092 CATCAGGTGGAGAATGAGGGTGG + Intergenic
1174362054 20:50035054-50035076 CATCAGGTGGAGAATGAGGGTGG + Intergenic
1174671947 20:52316631-52316653 GATGAGAGGGAAAAGGTGGAGGG + Intergenic
1175158224 20:56988547-56988569 CTGCAGAGGGACAGTGTGGGAGG - Intergenic
1176245644 20:64095250-64095272 CATCGGGGGGATAGTGTGGGGGG + Intronic
1176982188 21:15396048-15396070 CATCAAAGGATAAATGTGTGTGG - Intergenic
1177736001 21:25091138-25091160 CATGAGAGGGACTAAGTGGGAGG + Intergenic
1178516250 21:33249922-33249944 GGTCAGAGGGTAAATGTGGCTGG + Intronic
1179133723 21:38661169-38661191 CAGGGGAGGGAAAGTGTGGGAGG + Intronic
1179507291 21:41850283-41850305 CACCAGGAGGAAAGTGTGGGGGG - Intronic
1180040704 21:45277875-45277897 CATCAGAGGGGAGAGCTGGGTGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182114394 22:27747135-27747157 GATCAGAGGGCTAATGTAGGTGG - Intergenic
1182364685 22:29770545-29770567 CATCAGAGTGGAACTGTGGCAGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182951894 22:34383884-34383906 CATCAGAGGGAACTGGTGGGAGG + Intergenic
1183256967 22:36768727-36768749 CATGAGAGGGAAAATGGGGAGGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184974777 22:48053218-48053240 GTTCAGAGGTAAATTGTGGGAGG - Intergenic
950773604 3:15331965-15331987 CAACAAAGGGAAAAAGGGGGCGG - Intronic
954325967 3:49864183-49864205 CCTCAGAGGGATAATCTGGGTGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955952334 3:64255063-64255085 CCTAAATGGGAAAATGTGGGAGG - Intronic
956591903 3:70924161-70924183 CATCAGAGGGAAAAGCTGCAGGG + Intergenic
957517634 3:81276380-81276402 TATCATAAAGAAAATGTGGGGGG + Intergenic
957803051 3:85110273-85110295 AATAAGAGAGAAACTGTGGGGGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959582511 3:107996337-107996359 CAACAAAGGGAAAAAGTGCGTGG + Intergenic
959741994 3:109731133-109731155 CATGAGAGGGACACAGTGGGAGG - Intergenic
959892403 3:111570968-111570990 CACCAGAGTGAAAAGCTGGGAGG + Intronic
960226220 3:115172328-115172350 CATCACAGGGATAATGTGGTAGG + Intergenic
960499545 3:118419650-118419672 CATGAGAGGGAACCTGTGGGAGG - Intergenic
960590305 3:119359579-119359601 ACTCAGAGGGAAAATTGGGGTGG + Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961127456 3:124433047-124433069 CATCAGAAGGAAAATATGCCAGG + Intronic
961615523 3:128176424-128176446 CACCAGAAGAGAAATGTGGGTGG + Intronic
962076637 3:132088876-132088898 CATGAGAGTAAGAATGTGGGAGG - Intronic
962865552 3:139445610-139445632 CATGAGAGGGACCATGCGGGAGG - Intergenic
963260797 3:143189084-143189106 CTCCCAAGGGAAAATGTGGGAGG - Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963627210 3:147688830-147688852 CATGGGAGGGACACTGTGGGAGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964687915 3:159418010-159418032 CATCTGGGGTCAAATGTGGGTGG - Intronic
964793168 3:160471635-160471657 CATGGGAGGGACATTGTGGGAGG + Intronic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
965847085 3:172975903-172975925 CATGGTAGTGAAAATGTGGGGGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967004906 3:185374960-185374982 CATCAGGGTGAAACTGTTGGAGG + Intronic
967703050 3:192617309-192617331 CCTCAGAAGGAAAGTGGGGGAGG + Intronic
968403922 4:322602-322624 AATCAGAGTGAAAATGTGAGTGG + Intergenic
968467575 4:759998-760020 CAGGAGAGGGACAATGTGAGCGG - Intronic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
969680902 4:8642853-8642875 GACAAGAAGGAAAATGTGGGTGG - Intergenic
970104027 4:12559937-12559959 CATGGGAGGGAACCTGTGGGAGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG + Intergenic
971562051 4:28091099-28091121 CATTAGTGGGAAAAATTGGGAGG + Intergenic
972297770 4:37756680-37756702 GATCAGAGGGAAAAGGTATGAGG + Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973094972 4:46185766-46185788 CATCAGGGGTAAAATTTGGGGGG - Intergenic
974522667 4:63004708-63004730 CATAAGAAGGAAAATATGGCAGG - Intergenic
974713373 4:65632985-65633007 CATTAGAGGGAAAGTATTGGGGG + Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976764103 4:88581054-88581076 CATCAGAGGGCAAAGGAGGAAGG + Intronic
976776217 4:88708998-88709020 CTTAAGAAGGAAAATGTGGATGG + Intergenic
978277733 4:106972216-106972238 CATCAGTGTAAAAATGTGGGTGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979319089 4:119301421-119301443 CATCTGGGGGGAAATGGGGGTGG + Intronic
980525583 4:133988091-133988113 CATGGGAGGGACATTGTGGGAGG - Intergenic
981270362 4:142839677-142839699 CCTAAGAGGGAAAATGTGAGTGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982749069 4:159137347-159137369 CATAGGAGGGGAAATGTAGGAGG + Intronic
983141611 4:164156351-164156373 CTTCAGTAGGAAAATGGGGGAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985286056 4:188337114-188337136 CAGCAGATGGGAAAGGTGGGCGG - Intergenic
986044160 5:4021710-4021732 CATCAGAGGAGAAAGGTAGGGGG - Intergenic
986325075 5:6666744-6666766 CATCAGAAAGAACATGTGTGAGG - Intronic
986372784 5:7097606-7097628 CTTCAGAGGGAAGGTTTGGGTGG - Intergenic
987211135 5:15684452-15684474 CAGCAGTGGGAAAATGTGTTAGG + Intronic
987226540 5:15847623-15847645 CATTATATGGAAAAGGTGGGGGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992202663 5:74399518-74399540 CATCACAGGGAGGATGGGGGTGG - Intergenic
995389613 5:111626066-111626088 CATCAGAGGGACCTGGTGGGAGG + Intergenic
996179419 5:120400427-120400449 CATGGGAGGGAACCTGTGGGAGG + Intergenic
996922682 5:128787360-128787382 CATGAGAGGGAACTGGTGGGAGG - Intronic
999092986 5:148954006-148954028 CATCAGAAGGAAAAGATAGGAGG - Intronic
999973871 5:156891752-156891774 CATCATAGGGAGAATGAGGCTGG - Intergenic
1000040278 5:157480120-157480142 CATTAGAGGGAGAATGAGAGGGG + Exonic
1000282627 5:159795161-159795183 TAGCTGAGGGAAAATATGGGTGG - Intergenic
1003550721 6:7100109-7100131 CATCAGCTGCAAAATGGGGGTGG + Intergenic
1004192245 6:13473910-13473932 CATCAGAGATAAAATGAGTGGGG - Intronic
1005824179 6:29622607-29622629 AATCAGAGTGAAAGTGGGGGAGG + Intronic
1006674932 6:35755907-35755929 CATCAGAGGGAAACTCTGATTGG - Intergenic
1006693134 6:35907840-35907862 CAGCAGAGGGATGAGGTGGGAGG + Intronic
1007300398 6:40863677-40863699 CATCAGGGTGAAAATATTGGAGG + Intergenic
1007662656 6:43496242-43496264 ACTCAGAGGGTAAATGTGTGGGG - Intronic
1008241250 6:49114835-49114857 CTTAAGAGGGAAAAACTGGGAGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008774871 6:55026251-55026273 ATTCAGAGGGAAAGGGTGGGAGG - Intergenic
1010732338 6:79404446-79404468 CAGCAGAGGGAAGAAGTGGCTGG + Intergenic
1012924148 6:105250796-105250818 CAGCAGAGGGAAAAAGTGCATGG + Intergenic
1014654283 6:124079968-124079990 CCTCAGAGAGAAATGGTGGGTGG + Intronic
1016000531 6:139036738-139036760 CATCAGGGGGCCAAGGTGGGAGG + Intronic
1016643534 6:146378187-146378209 GTGCAGAAGGAAAATGTGGGGGG + Intronic
1017235555 6:152114054-152114076 CACCATAGGGAAGGTGTGGGAGG + Intronic
1018101583 6:160445529-160445551 CATCAGAGGGACGATGCTGGGGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019720377 7:2566921-2566943 CATCAGAAGGAATGGGTGGGTGG - Intronic
1021377454 7:19925354-19925376 CAGAAGAGGGAAAAAGTGGATGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1023469474 7:40499020-40499042 CATCAGAGGCAAAACAAGGGAGG - Intronic
1023798866 7:43815538-43815560 CAGCAGAGAGGAAAGGTGGGGGG + Intergenic
1024894745 7:54244993-54245015 CATCAGTTGGAATATGGGGGTGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026373057 7:69721171-69721193 GATCAGAGAGAGATTGTGGGAGG - Intronic
1026600086 7:71770634-71770656 ATCCAGGGGGAAAATGTGGGTGG - Intergenic
1030191051 7:106810495-106810517 CCTAAGAGGGAAGATGTAGGTGG - Intergenic
1030619913 7:111777690-111777712 CATGGGAGGGACAAGGTGGGAGG + Intronic
1031772768 7:125865959-125865981 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1032214991 7:129951324-129951346 CAACAGGGGGAAACGGTGGGGGG + Intronic
1032702764 7:134396936-134396958 TTGCAGAGAGAAAATGTGGGAGG + Intergenic
1033322139 7:140349525-140349547 CATCAAAGGAAAAAGGGGGGGGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033652358 7:143352668-143352690 CAACGGAGGGGGAATGTGGGCGG - Intergenic
1034840239 7:154388706-154388728 CATCACAGGGAAGATGTGAATGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035278208 7:157760558-157760580 GAGCACAGGGAAGATGTGGGAGG - Intronic
1036434457 8:8720525-8720547 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1038238706 8:25787831-25787853 CAACAGAGAGAAATTGTGAGAGG + Intergenic
1038242429 8:25822236-25822258 CATTAGAGGCTAAGTGTGGGAGG + Intergenic
1038327504 8:26583371-26583393 CACCAGAAGGAAAATAGGGGTGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039029442 8:33293782-33293804 CATAAGAGGGACATGGTGGGAGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040677420 8:49766891-49766913 CAAGAGAGAGAGAATGTGGGTGG - Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1044504296 8:93000513-93000535 CATGGGAGGGAAATGGTGGGAGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045572210 8:103379840-103379862 GATCTGAGGGAAAATGTGGAGGG - Intronic
1045641574 8:104257293-104257315 TCTCAGAGGAAAAATGTGGATGG - Intergenic
1045842354 8:106594863-106594885 CATCAGAGGGAAATTGGCAGGGG + Intronic
1046391341 8:113576840-113576862 CATGAGAGGGACCCTGTGGGAGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046786353 8:118271359-118271381 CATGGGAGGGAATTTGTGGGAGG - Intronic
1047056760 8:121173718-121173740 CATGAGAGGGAACCCGTGGGAGG - Intergenic
1047702556 8:127464184-127464206 CATCAGAGGGGACATGTCTGGGG - Intergenic
1047885077 8:129241244-129241266 CATCAGAGGCACATTGTGGATGG + Intergenic
1047895694 8:129363982-129364004 CTTCAGATGGAAAAGCTGGGGGG + Intergenic
1048356736 8:133660210-133660232 AGTCAGAGGGAAGATGTAGGAGG + Intergenic
1048715597 8:137265232-137265254 TAGCATAGGGAAAATGGGGGTGG + Intergenic
1048773276 8:137918732-137918754 CAACAGAGGGATCTTGTGGGAGG + Intergenic
1049924512 9:395491-395513 ACACAGAGGGCAAATGTGGGTGG + Intronic
1049980966 9:903269-903291 CTTCAGAGGAGTAATGTGGGTGG - Intronic
1050313841 9:4380964-4380986 AATTAGAAGAAAAATGTGGGAGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051729051 9:20120048-20120070 CAAATGAAGGAAAATGTGGGTGG - Intergenic
1052364328 9:27595302-27595324 ATTCAGAGGGTAAATGTGCGGGG - Intergenic
1052499292 9:29268880-29268902 TATCAGTAAGAAAATGTGGGAGG + Intergenic
1053068852 9:35088866-35088888 CATCTGAGGGACAAGGGGGGCGG - Exonic
1053556954 9:39146964-39146986 CATGGGAGGGAACCTGTGGGAGG + Intronic
1053607740 9:39678575-39678597 CACCACAGGGAAAGTGTGAGTGG + Intergenic
1053821064 9:41967234-41967256 CATGGGAGGGAACCTGTGGGAGG + Intronic
1054089935 9:60835373-60835395 CATGGGAGGGAACCTGTGGGAGG + Intergenic
1054111346 9:61110931-61110953 CATGGGAGGGAACCTGTGGGAGG + Intergenic
1054245795 9:62663834-62663856 CACCACAGGGAAAGTGTGAGTGG - Intergenic
1054559920 9:66698365-66698387 CACCACAGGGAAAGTGTGAGTGG - Intergenic
1054581315 9:66917255-66917277 TGTAAGAGGGAAGATGTGGGAGG + Intronic
1054609511 9:67220194-67220216 CATGGGAGGGAACCTGTGGGAGG - Intergenic
1055633191 9:78245991-78246013 CATCACAGGCAAAAACTGGGTGG - Intronic
1056453865 9:86741843-86741865 CATCCAAGGGAAGAGGTGGGTGG - Intergenic
1057670311 9:97080635-97080657 CATAAGAGGCCAAATGTGAGTGG - Intergenic
1058906555 9:109486763-109486785 CATGGGAGGGAACAGGTGGGAGG + Intronic
1060216403 9:121741099-121741121 CATCAGAGGAAACAGGTGGGTGG - Intronic
1060452293 9:123754362-123754384 CAACAGAGGGAAAGTGTCAGTGG + Intronic
1061436040 9:130562816-130562838 CATGAGAGGGAACCGGTGGGAGG - Intergenic
1061467047 9:130789195-130789217 CATCAGAGAGAAAATGTACGGGG + Intronic
1062227970 9:135464576-135464598 CACCAGAAGGGAAATGTGGCCGG + Intergenic
1062720122 9:138036763-138036785 CAACATTGGCAAAATGTGGGTGG - Intronic
1186080413 X:5924846-5924868 ACTCAGAGGGAAAGGGTGGGAGG + Intronic
1186474600 X:9847531-9847553 AATCAGAGGGAAAAGGGGGTTGG + Intronic
1186772521 X:12831742-12831764 CATCAAAAGGATAATGTGGCTGG - Intergenic
1187649060 X:21380047-21380069 CAGTAGAGGGAAAGTGAGGGAGG + Intronic
1188004248 X:25006110-25006132 TGTCAGAGGGAAAAAGTGGAGGG + Intronic
1188276277 X:28205566-28205588 AATGAGAGGGAAAATGAGGGAGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188901051 X:35733673-35733695 CATCTTAGGGAGAATATGGGTGG + Intergenic
1188955095 X:36424831-36424853 CATAAGAAGGAAAATGAGGTTGG + Intergenic
1189423914 X:40881380-40881402 CCTGTGAGAGAAAATGTGGGAGG + Intergenic
1189438959 X:41017480-41017502 AATCAAAGGAAGAATGTGGGAGG - Intergenic
1189489754 X:41461169-41461191 ACTCAGAGGGAAAGGGTGGGAGG - Intronic
1189523974 X:41800313-41800335 CTTCAGAGGGAGGATCTGGGTGG + Intronic
1189798060 X:44664795-44664817 CATAAGAGGGACCCTGTGGGAGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190299793 X:49050456-49050478 CATCAAAGGGAAAATTGAGGTGG + Intergenic
1192902029 X:75509961-75509983 CATCTAAGAGAAAAAGTGGGGGG - Intronic
1194916004 X:99709443-99709465 CACCAGAGGGAAAAAATTGGGGG + Intergenic
1194980832 X:100438626-100438648 CAGGAGAGGGTAAATGTAGGAGG + Intergenic
1195815040 X:108875585-108875607 AGTCAGAGGGAATAAGTGGGAGG + Intergenic
1196098119 X:111821346-111821368 TCTAAGAGTGAAAATGTGGGAGG - Intronic
1197059048 X:122154687-122154709 CATGAGAGGGACCAAGTGGGAGG + Intergenic
1197956895 X:131960757-131960779 AATTAGAGTCAAAATGTGGGGGG + Intergenic
1199313650 X:146350831-146350853 CAATAGAGGGAAAATTTGAGTGG + Intergenic
1200332768 X:155314584-155314606 TGTCAGAGGGAAGATCTGGGAGG - Intronic
1201233733 Y:11890703-11890725 CATCAGGGGGAAAGTATTGGAGG + Intergenic
1201455000 Y:14160088-14160110 CATCAGAGAGAAAATACTGGGGG - Intergenic
1201617080 Y:15912534-15912556 CATGGGAGGGAACCTGTGGGAGG + Intergenic
1201891242 Y:18946152-18946174 CATCAGGGTGAAAGTGTTGGAGG + Intergenic
1202374202 Y:24218344-24218366 CATCAGAGGGGATCTGTGGCTGG + Intergenic
1202496579 Y:25451776-25451798 CATCAGAGGGGATCTGTGGCTGG - Intergenic