ID: 1092052079

View in Genome Browser
Species Human (GRCh38)
Location 12:5478961-5478983
Sequence GAAGCTCTGATTGTGCTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092052079 Original CRISPR GAAGCTCTGATTGTGCTGAC GGG (reversed) Intronic
904695665 1:32329632-32329654 GAATCTCTGGATGGGCTGACTGG - Intronic
906793160 1:48676288-48676310 GAAGGTCTGAAGGTGCTGGCAGG + Intronic
906798318 1:48714829-48714851 GAAGCTCTCATATTGCTGAAGGG + Intronic
907281519 1:53350101-53350123 CAATCCCTGACTGTGCTGACTGG + Intergenic
911195134 1:94986907-94986929 GATGCTCTGATTGGTCAGACTGG - Intronic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
920597185 1:207283893-207283915 GAAGCCCTGCTTGTGCTGACTGG + Intergenic
1065266341 10:23980249-23980271 GAGGGGCTGAGTGTGCTGACAGG + Intronic
1067916472 10:50404896-50404918 GAAGATCTGTATGTGTTGACAGG + Intronic
1069743141 10:70698445-70698467 AAACCTCTCATTGTGCAGACAGG + Intronic
1074362924 10:112837479-112837501 GCAGCTCTGATTGAGCTGTGGGG - Intergenic
1078464818 11:11542237-11542259 GGAGCTCTGAGTGAGATGACAGG - Intronic
1080418566 11:32091342-32091364 GAAGCTCTGGTTGTCCTCAGGGG - Exonic
1080751326 11:35152893-35152915 GATGCTTTGCTAGTGCTGACGGG + Intronic
1081380342 11:42407296-42407318 GAAGCTCAGACAGTGCTAACAGG + Intergenic
1084359377 11:68659756-68659778 GAGGCTCTGAGTGCCCTGACAGG + Intergenic
1085515953 11:77112164-77112186 GGCGCTCAGATTGGGCTGACTGG + Intronic
1087181237 11:95144515-95144537 GGAGCTCTGATTCTGGAGACGGG + Intergenic
1089304334 11:117517298-117517320 GGGGCTCTGATAGTGCTGGCTGG + Intronic
1089590583 11:119537899-119537921 CAAGCTTTGTTTGTGCTGCCAGG - Intergenic
1089980462 11:122767735-122767757 AAAGCTCTGACTGTGCAGTCAGG + Intronic
1092052079 12:5478961-5478983 GAAGCTCTGATTGTGCTGACGGG - Intronic
1092546279 12:9454370-9454392 GAAAATCTGATTGTATTGACTGG + Intergenic
1095042905 12:37463926-37463948 GAATCTCTAACTGGGCTGACTGG - Intergenic
1097761501 12:63470838-63470860 GATGCTTTGGTGGTGCTGACTGG + Intergenic
1097907073 12:64931484-64931506 CAAGCCCTGATGGTGGTGACAGG + Intergenic
1100047149 12:90396339-90396361 GAAGCTCTGGCTTGGCTGACTGG + Intergenic
1103779732 12:123390170-123390192 GGGGCTCTGGCTGTGCTGACAGG + Intronic
1105242984 13:18624157-18624179 GATGCTCTGATTAGGCTGAAGGG - Intergenic
1105841967 13:24261430-24261452 GAAGCTCTGATTTTGAGGAAGGG + Intronic
1107942969 13:45391181-45391203 GAAGCTCTGGTTGTCCTCAGGGG + Intergenic
1110355158 13:74558965-74558987 GAATCTCTGATTATTCTAACGGG + Intergenic
1114375212 14:22138938-22138960 GAAGTTCTGATGGTACTCACAGG - Intergenic
1118010835 14:61608921-61608943 GCAGCTCCCATTGTGCTGAGTGG + Intronic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1120067210 14:80056637-80056659 GATGCTGTGTTTGTGCTGATGGG - Intergenic
1120236858 14:81902888-81902910 GAATTTCTGAATGAGCTGACTGG - Intergenic
1120242628 14:81966884-81966906 CAAACTCTGATGGAGCTGACAGG - Intergenic
1120968338 14:90187021-90187043 GAAGCTCTGTTTGGGGTCACAGG - Intergenic
1202941443 14_KI270725v1_random:151529-151551 GAATCTCTAACTGGGCTGACTGG - Intergenic
1123488310 15:20760474-20760496 GATGCTCTGATTAGGCTGAGGGG + Intergenic
1123544808 15:21329547-21329569 GATGCTCTGATTAGGCTGAGGGG + Intergenic
1124303941 15:28565249-28565271 GAAGCACTGAAGGTGCTGGCCGG + Intergenic
1125256502 15:37769916-37769938 GAAGATCTGTTTGTACTGATGGG - Intergenic
1125481465 15:40083842-40083864 CAGTCTCTGAATGTGCTGACAGG + Intergenic
1126292031 15:47091879-47091901 GAATCTCTAACTGGGCTGACAGG + Intergenic
1127779315 15:62297490-62297512 GGAGTTCTGATAGTGCTGATTGG + Intergenic
1131321627 15:91399592-91399614 GAATCTCTGGATGTGCTGACTGG - Intergenic
1202953153 15_KI270727v1_random:56818-56840 GATGCTCTGATTAGGCTGAGGGG + Intergenic
1135426039 16:22336363-22336385 GAATCTCTGAATGGGCTCACTGG + Intergenic
1137478278 16:48829694-48829716 GAAGCTCACCTTGTCCTGACTGG + Intergenic
1138033171 16:53577408-53577430 GAACCTATGATTGTGGGGACGGG + Intergenic
1140069160 16:71634331-71634353 GTGGCTTTGATGGTGCTGACGGG + Intronic
1141825710 16:86478351-86478373 GAAGCTCTGTGGGGGCTGACAGG + Intergenic
1150551456 17:66214390-66214412 AAGGCTCTGATTATGATGACGGG + Intronic
1153952664 18:10070269-10070291 GATGCTCTGAAGGTGCTGCCTGG + Intergenic
1154445955 18:14435740-14435762 GATGCTCTGATTAGGCTGAAGGG + Intergenic
1157086601 18:44586673-44586695 CAAGCTCTGCATGTGCTGCCTGG + Intergenic
1157662437 18:49457705-49457727 GAAGCTCTGATTATGTTGCTGGG + Intronic
1159462755 18:68741491-68741513 GAAACTGTGAATGTGCTGATGGG + Intronic
1161138915 19:2636686-2636708 GAGGCTCTGAGTGTGCCCACAGG + Intronic
1161789332 19:6349626-6349648 GATGCTCTGATGGGGCTCACTGG - Intergenic
1165474004 19:36019100-36019122 GCAGTTCTGATGCTGCTGACTGG - Intronic
1168240666 19:55087310-55087332 GACGCGCTGGGTGTGCTGACCGG + Exonic
926150891 2:10425084-10425106 GCAGCTCTGGTTCTCCTGACTGG + Intronic
926537322 2:14129205-14129227 GAAGATGTGGATGTGCTGACAGG + Intergenic
926983696 2:18598368-18598390 GAAGCTGTCTTTGTGTTGACTGG + Intergenic
927503317 2:23596584-23596606 GAAGATGAGATTGTGCTGGCGGG + Intronic
928122187 2:28591358-28591380 GAAGCTGTGATTGGGTTGGCTGG - Intronic
929162751 2:38849413-38849435 GTCAGTCTGATTGTGCTGACGGG + Intronic
933401428 2:81802108-81802130 CAAGCTCTGTCTTTGCTGACTGG - Intergenic
935808761 2:106774757-106774779 GAGGCTCTCATTGTGCGTACAGG - Intergenic
938727438 2:134120624-134120646 GAAGCTCTGGTTGCGCGGGCTGG + Intronic
939145915 2:138414589-138414611 GAATATCTGATTGAGTTGACTGG - Intergenic
940391273 2:153135282-153135304 GAAGCTCTGTTTTTGGAGACAGG - Intergenic
948519958 2:238529915-238529937 GAAACTGTGATTGTGCTGCAAGG - Intergenic
948587238 2:239027128-239027150 AATGCACTGAGTGTGCTGACAGG - Intergenic
948939083 2:241187344-241187366 CAGGCTCTGCTGGTGCTGACAGG + Intergenic
948951604 2:241255952-241255974 GGGCCTCTGACTGTGCTGACAGG - Intronic
948988273 2:241539383-241539405 CAGGCTCTGAATGTGCTGAGTGG + Intergenic
1169331740 20:4721799-4721821 GAAGCCCTGATTGGTCTGCCGGG + Intergenic
1171537324 20:25906681-25906703 GAATCTCTAACTGGGCTGACTGG - Intergenic
1174353122 20:49982283-49982305 GAGGCTCTGAGTGTTCTGTCCGG + Intergenic
1176450024 21:6854117-6854139 GATGCTCTGATTAGGCTGAAGGG - Intergenic
1176581718 21:8535405-8535427 GAATCTCTAACTGGGCTGACTGG + Intergenic
1176828193 21:13719135-13719157 GATGCTCTGATTAGGCTGAAGGG - Intergenic
1180264553 22:10512477-10512499 GAATCTCTAACTGGGCTGACTGG + Intergenic
1183441964 22:37828236-37828258 GAAGTACAGAGTGTGCTGACTGG + Intergenic
1183729488 22:39609888-39609910 GGAGCTCTGCCTGTGCTGACTGG + Intronic
1184349515 22:43934485-43934507 CAAGCTCTGAGTCTGCTGGCTGG - Intronic
1185423033 22:50745616-50745638 GCAGCTGTGAGTGAGCTGACGGG + Intergenic
953470613 3:43162952-43162974 GAAACTCAGGTTGAGCTGACAGG + Intergenic
957166701 3:76682995-76683017 GATTCTCTGATTGTTCTGTCTGG - Intronic
957595677 3:82262642-82262664 CAAGCTTCCATTGTGCTGACTGG + Intergenic
959823653 3:110767470-110767492 AAAGCTCTGTTGGTGCTCACTGG + Intergenic
960648963 3:119924988-119925010 AAACCTCTAATTATGCTGACTGG + Intronic
960782100 3:121330914-121330936 CCAGCTCTGATGGTGGTGACAGG - Intronic
961123573 3:124395745-124395767 AATGATCTGATTTTGCTGACTGG - Intronic
961602158 3:128070804-128070826 TAAGTTCTGTTTGTGCTGACAGG + Exonic
962918835 3:139933755-139933777 GAGGCTCTGAGTGAGCTGCCAGG + Intergenic
966284637 3:178279265-178279287 GAATCTCTGAATGAGCTTACTGG + Intergenic
966952317 3:184832783-184832805 CAAGCTCAGATAGTGGTGACAGG + Exonic
971221891 4:24716622-24716644 GAATCTCTGGATGGGCTGACTGG - Intergenic
978548736 4:109901346-109901368 GAAGGTGTGATTGAACTGACTGG + Intergenic
982743558 4:159082981-159083003 TCAGCTCTGATTATGCTGTCAGG - Intergenic
984338636 4:178424920-178424942 GAATCTGTTATTGTGATGACTGG - Intergenic
984924985 4:184798737-184798759 GTAGCACTGATTGTGATCACTGG + Intronic
989765407 5:45076764-45076786 GAATCTCTGCTGCTGCTGACAGG + Intergenic
990486162 5:56261167-56261189 GGAGCTCTGTTTGTGTTTACTGG - Intergenic
993132232 5:83913199-83913221 GAAGCTCTGGATGAGATGACTGG + Intergenic
995409817 5:111843720-111843742 GAATCTCTAAATGGGCTGACTGG - Intronic
996040968 5:118810336-118810358 GAATCTCTGAATGAGCTGACTGG + Intergenic
997825849 5:137106301-137106323 GAAGCACTGATGCTGCTGACTGG - Intronic
1001952095 5:175823525-175823547 GCAGCTCTGTTTGTGTTTACAGG - Intronic
1006404304 6:33835246-33835268 GGGGCTCTGATTGGTCTGACTGG + Intergenic
1008724360 6:54398490-54398512 GAAGCAATGATTGTACTGAGGGG - Intergenic
1014506735 6:122268837-122268859 GGAGCCCTGATTGTGCCCACAGG + Intergenic
1019518982 7:1452149-1452171 GAAGCTCCGCCTGTGCAGACGGG - Intronic
1020378507 7:7515191-7515213 GAACCTCTGAGAGTGCTCACTGG - Intronic
1023505087 7:40890655-40890677 GAACCTCTGCATGGGCTGACTGG + Intergenic
1025288802 7:57693515-57693537 GAATCTCTAATTGGGCTGACTGG - Intergenic
1027179703 7:75929841-75929863 GAAACTCTGTTTTTGCTGAATGG + Intronic
1027931790 7:84546514-84546536 GTAGCTCTCATTGAGCTGAATGG + Intergenic
1029834143 7:103291471-103291493 GAAGCTCTTTCTGTGCTCACTGG - Intergenic
1032744240 7:134770203-134770225 GTAGCTCTGCTGGTGTTGACTGG + Intronic
1034836932 7:154361176-154361198 GAAGATCTGAGTGTGCCTACTGG + Intronic
1039379764 8:37074277-37074299 GAAGCTCTGATTCTGATTAGAGG + Intergenic
1039779464 8:40770094-40770116 AAAGCTCTGATTTTCCTCACCGG - Intronic
1041622491 8:59989708-59989730 GAATCTCTGGTCATGCTGACTGG - Intergenic
1042936204 8:74060998-74061020 GAACCTCTGTTTGTGTTCACAGG + Intergenic
1045542811 8:103102717-103102739 GGAGATCTGAGTGTGCTGAGTGG + Intergenic
1045907575 8:107366260-107366282 TTAGCTCTGCTTGTGCAGACAGG + Intronic
1050479592 9:6076002-6076024 GAAGCCCTGAGTGAGCTGGCAGG - Intergenic
1050884272 9:10743930-10743952 AAAACTCTCATTGTTCTGACTGG + Intergenic
1057448730 9:95137744-95137766 GAAGCTCTGAGTGTGGAGGCAGG + Intronic
1058619262 9:106864996-106865018 GAAGCTCTGTTGGTGATGGCTGG + Intronic
1203519158 Un_GL000213v1:30400-30422 GATGCTCTGATTAGGCTGAAGGG + Intergenic
1203611737 Un_KI270749v1:13442-13464 GAATCTCTAACTGGGCTGACTGG + Intergenic
1186635420 X:11399067-11399089 GAAGCTCTGATTTTTCTGTTGGG - Intronic
1189382694 X:40513065-40513087 GAGGCTCTGCTTCTGCTGATGGG + Intergenic
1191937120 X:66437896-66437918 GAAGCTCTGAGTGTGCCCAGCGG + Intergenic
1194050023 X:89056634-89056656 GAGGCTCTATTTGTGCTGCCTGG + Intergenic
1195136008 X:101907412-101907434 GAATCTCTGGATGGGCTGACTGG + Intronic