ID: 1092052256

View in Genome Browser
Species Human (GRCh38)
Location 12:5480296-5480318
Sequence GGGTGGAAAAACAATCCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092052251_1092052256 12 Left 1092052251 12:5480261-5480283 CCTGTTTGCATTCGCAACGGGAA 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1092052256 12:5480296-5480318 GGGTGGAAAAACAATCCCACCGG 0: 1
1: 0
2: 1
3: 9
4: 130
1092052248_1092052256 20 Left 1092052248 12:5480253-5480275 CCAGAATGCCTGTTTGCATTCGC 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1092052256 12:5480296-5480318 GGGTGGAAAAACAATCCCACCGG 0: 1
1: 0
2: 1
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092052256 Original CRISPR GGGTGGAAAAACAATCCCAC CGG Intronic
900314860 1:2051451-2051473 AGGTGGAAGAACAAACCCACGGG - Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
903399748 1:23033158-23033180 TGGTAGAGAAACAAACCCACAGG - Intronic
904270351 1:29345770-29345792 GTCTGGAAAACCCATCCCACTGG + Intergenic
904858472 1:33517637-33517659 GCATGCTAAAACAATCCCACTGG + Intronic
912543768 1:110436437-110436459 GGGTGGAAAATCAAGGCCAGAGG + Intergenic
914165638 1:145173041-145173063 GGCAGGAAACACAATCCCTCAGG + Intergenic
915447373 1:155981649-155981671 GGGTGGACAAACAGACCAACCGG + Intronic
916920392 1:169460420-169460442 GGGTGGAAAGACCATCCGAGGGG + Exonic
918598898 1:186329133-186329155 GGGTGGAATAAAAATCCAAATGG + Intronic
919856002 1:201706538-201706560 TGGGGGAACAACAATCCCTCAGG - Intronic
919930478 1:202218105-202218127 GGGTGGAAAGAGCATCCCCCAGG + Intronic
922228909 1:223668649-223668671 GGCAAGAAAAACAATCCCATAGG - Intergenic
922447680 1:225711316-225711338 GGGTAGATAAAAAAGCCCACGGG + Intergenic
923302474 1:232654327-232654349 GGGTGAAAAAAAAAACCCAAGGG - Intergenic
1065997782 10:31075286-31075308 TGGTGGCAAAACAGACCCACAGG + Intergenic
1068628687 10:59277283-59277305 GGTTTGGAAAACAATCCCACAGG + Intronic
1071773260 10:88754146-88754168 GGGTTGGAAAACAATCACCCAGG + Intergenic
1073332043 10:102676552-102676574 GAGAGGAAAAAAAAGCCCACTGG + Exonic
1075265442 10:120996872-120996894 CGGTGGCAAAACAAACACACAGG + Intergenic
1080698229 11:34621507-34621529 GGGTGGCAAAACCATTCCCCTGG + Intronic
1085191668 11:74631112-74631134 GGTTGAAAATAAAATCCCACTGG - Intronic
1086759658 11:90612090-90612112 GGGGAGAAAAAGAATCCCTCAGG + Intergenic
1087983672 11:104650322-104650344 GGTTGGAAAAATAATCACATGGG + Intergenic
1090991704 11:131823072-131823094 CTATGGAAAAACAATCTCACTGG - Intronic
1092052256 12:5480296-5480318 GGGTGGAAAAACAATCCCACCGG + Intronic
1094698592 12:32846311-32846333 GGGAGAAAGAACAATCTCACCGG + Intronic
1097316091 12:58172916-58172938 GTGTGGAAACACCACCCCACTGG + Intergenic
1097796891 12:63872176-63872198 GGGTACAAAAACAATCAAACAGG - Intronic
1098462124 12:70743419-70743441 GGAAGGAAAAACAATACCAGAGG + Intronic
1102429971 12:112875536-112875558 GGCTGCAGAAACAGTCCCACTGG - Intronic
1102613514 12:114133226-114133248 GCTGGGAAAAAAAATCCCACTGG + Intergenic
1104652458 12:130545888-130545910 TTGTGGAAAAACAAAGCCACAGG + Intronic
1104703579 12:130925582-130925604 TGCTGGAAACACAAACCCACAGG - Intergenic
1108390877 13:49946488-49946510 GGGTGGCAAAACAATCGAACAGG - Intergenic
1109261790 13:60153531-60153553 GGGTGGAAATGGAATCCCAGAGG - Intronic
1109264321 13:60179292-60179314 GGGTGGCAAATCAAACCCAGTGG - Intergenic
1110713898 13:78680028-78680050 ATGTGAAAAATCAATCCCACAGG + Intergenic
1112560804 13:100512151-100512173 AGTTTTAAAAACAATCCCACTGG + Intronic
1114626457 14:24133117-24133139 GGCAGGAAAAACAATCAAACAGG - Intergenic
1116343394 14:43755265-43755287 GGGTGGAAACACAATGCCACAGG - Intergenic
1120076529 14:80165573-80165595 AGGTGAAAACACAATCTCACAGG - Intergenic
1202903514 14_GL000194v1_random:56076-56098 GGGTGGAAATGCAATCCTGCCGG + Intergenic
1124577548 15:30923124-30923146 GGGTGGAAAAAAACGACCACTGG + Intronic
1127410839 15:58705274-58705296 GGGTAGGAAAACATTCCCAGTGG - Intronic
1130640938 15:85674518-85674540 AGGTGTAAAAACAACCCCAAGGG - Intronic
1135250303 16:20895567-20895589 GGGTCCAAAACCAATCCCCCAGG + Intronic
1140123323 16:72101428-72101450 CAATGGAAAATCAATCCCACGGG - Intronic
1141935905 16:87237486-87237508 GGGAGAAAAAACAACCCCAGAGG + Intronic
1143336471 17:6175275-6175297 GGGTGGAAGACCACTCCCAGCGG + Intergenic
1144488454 17:15686919-15686941 GGCCTGAGAAACAATCCCACAGG - Intergenic
1144912559 17:18695386-18695408 GGCCTGAGAAACAATCCCACAGG + Intergenic
1146610303 17:34299085-34299107 GGATGGGAAAAGAAACCCACTGG - Intergenic
1148530827 17:48389601-48389623 GGGAAAAAAATCAATCCCACAGG - Intronic
1150164000 17:62924133-62924155 GAGTGGAAGAGCAACCCCACAGG - Intergenic
1151071569 17:71219392-71219414 TGGTGGAAAAAAAATCCCGAAGG + Intergenic
1151303947 17:73250952-73250974 GGGTGGACAAAGGAACCCACAGG - Intronic
1159070143 18:63613787-63613809 GGGTGGGGAGACAACCCCACTGG - Intergenic
1159070347 18:63615980-63616002 GGGTGGGGAGACAACCCCACTGG - Intergenic
1159682497 18:71372336-71372358 GGGTGGCAAGAGAATCCCACAGG - Intergenic
1162719863 19:12656053-12656075 AGGTGGAAAAAAAAACCCACCGG + Intronic
1168025328 19:53639623-53639645 GTTTGGCTAAACAATCCCACAGG + Intergenic
925871713 2:8277661-8277683 GGGCGAAGTAACAATCCCACTGG + Intergenic
926784987 2:16509671-16509693 GGATGCAAAAATATTCCCACAGG - Intergenic
935266259 2:101397175-101397197 GGGAGGAAAAATATTACCACTGG + Intergenic
935338303 2:102036841-102036863 AGGTGAAACAACAATGCCACTGG + Intergenic
938580222 2:132639051-132639073 AGCTGGATAAACATTCCCACAGG - Intronic
940142518 2:150508765-150508787 GGGTGGAAAAAAAATCTCAGTGG + Intronic
948681143 2:239635382-239635404 TGGTGAAAAGACAGTCCCACTGG - Intergenic
1169501022 20:6160979-6161001 AGGTGGAGGAACAATACCACAGG - Intergenic
1170745117 20:19092114-19092136 GGGTTGAGAAACATTCCCACGGG + Intergenic
1173696233 20:45016326-45016348 GGGTGGAAAAAAAATCCAGTCGG - Intronic
1173978628 20:47206201-47206223 GAGTGGAATAACCACCCCACTGG + Intergenic
1176622882 21:9070844-9070866 GGGTGGAAATGCAATCCTGCCGG + Intergenic
1178112604 21:29383831-29383853 GGGTATATAAACAATACCACAGG - Intronic
1178318485 21:31586902-31586924 GGGTTGAGAAAGAATCACACAGG + Intergenic
1178339591 21:31774720-31774742 GGGTGGAAGCACAATCCAACAGG - Intergenic
1179536641 21:42057073-42057095 GGATGGAAAAACGCTCCCAATGG + Intergenic
951343602 3:21519129-21519151 GGGGGGAAAGATAATACCACAGG + Intronic
952874032 3:37926857-37926879 GGGTGGGAAAGATATCCCACAGG + Intronic
953572226 3:44080075-44080097 GGGTGGAACAACCACACCACAGG + Intergenic
955544554 3:60014031-60014053 TGGTGGAAAAACATTTCCATGGG - Exonic
956913374 3:73844789-73844811 GGGTGAAAAACAAATCACACTGG + Intergenic
959562130 3:107794995-107795017 GGGTGTAAAAACTAGCCCAGTGG + Intronic
959646825 3:108712824-108712846 GGGTAGAAAAACTAACCCATGGG + Intergenic
962350127 3:134650551-134650573 GGGAGGAAAAAGACTCCCAGGGG + Intronic
963030784 3:140973210-140973232 GGGTTGAAAGAGAATCCCTCAGG + Intronic
963080136 3:141384194-141384216 GGGTGGACAGAGAACCCCACAGG + Intronic
963864472 3:150345158-150345180 GGGTGTTAAAACATTCCCAAAGG + Intergenic
964123909 3:153216278-153216300 GGGTTGAAAAACAATCCACATGG + Intergenic
969091987 4:4701647-4701669 GGTTAGAAAAACCCTCCCACTGG - Intergenic
971231362 4:24802179-24802201 GGATGGATAAACTATCCCATGGG + Intergenic
971411790 4:26380926-26380948 GGCTGAAAAAACAAGCTCACAGG - Intronic
972369499 4:38409375-38409397 GGGAGGAAGAAAAACCCCACAGG - Intergenic
974406230 4:61474349-61474371 GGGAGGCAAAACAAACCCTCCGG - Intronic
976086111 4:81408765-81408787 TGCTGGAAAAAAAAACCCACTGG - Intergenic
976224634 4:82785977-82785999 GGGTTGATAAACTATTCCACGGG + Intronic
976549908 4:86381952-86381974 GGGAGGAAAAACAATGTCAAGGG - Intronic
977179648 4:93857719-93857741 GGCTGGAGAAACAGCCCCACTGG + Intergenic
979174752 4:117650048-117650070 GGGGGGAAAAACACACACACTGG + Intergenic
979701977 4:123679472-123679494 GAGTAGAGAAACATTCCCACAGG - Intergenic
985799693 5:1996384-1996406 TGGGGGAAAAAAAATTCCACAGG + Intergenic
988809604 5:34771464-34771486 GGGAGGAAATACAAACTCACTGG - Intronic
994658747 5:102627461-102627483 GGCTGGAAAAACTAACCAACAGG + Intergenic
997161723 5:131615933-131615955 GGGTGGGAAAACTATCCACCTGG + Intronic
997599751 5:135131145-135131167 GGGTGGAAAGGCATTCCCAGTGG + Intronic
998562092 5:143181158-143181180 GCATGGTAGAACAATCCCACAGG - Intronic
1000681512 5:164190737-164190759 AGTTGGAAAGACAATCCCAGAGG + Intergenic
1003504412 6:6728029-6728051 GGGTGGCAAATGAATCGCACAGG - Intergenic
1007161388 6:39793982-39794004 GGATGTAAAAACAGACCCACAGG + Intronic
1007503840 6:42319089-42319111 AGGTGGAGAAACACTGCCACAGG - Intronic
1014310819 6:119799165-119799187 GGGTGGGAAAATAATAGCACAGG - Intergenic
1016107148 6:140176996-140177018 TTGTGGGAAAACAATCACACAGG + Intergenic
1016672262 6:146722504-146722526 GGGGAGAAAAACAAACACACTGG + Intronic
1017815332 6:158012134-158012156 GGGTGCAATGACAAACCCACTGG - Intronic
1017944735 6:159086285-159086307 AGGTGGAAAAATCAGCCCACTGG - Intergenic
1020976151 7:15009369-15009391 AGGTGTAAAAAATATCCCACAGG - Intergenic
1024666256 7:51550103-51550125 GGGCTGAAAAACAAACCCAGGGG + Intergenic
1026413587 7:70154681-70154703 GGTTGTACAAACAATGCCACTGG + Intronic
1028097615 7:86781639-86781661 AGGTGAGAAAACAATCTCACAGG - Intronic
1028427133 7:90702111-90702133 GGGTGGAAAAACCATTCCCCAGG + Intronic
1028746521 7:94333656-94333678 AGGTGGGAAATCACTCCCACTGG - Intergenic
1029513666 7:101012689-101012711 GGGTGGGCAAAGACTCCCACGGG + Intronic
1032495211 7:132356210-132356232 GGATAGAAAAACAGACCCACTGG - Intronic
1040409879 8:47143448-47143470 TGGAGGAAGAACAACCCCACTGG + Intergenic
1040961632 8:53040038-53040060 GGATGGAAAAACTATCCATCGGG - Intergenic
1041542703 8:59004694-59004716 GGATGAAAAATCAATCACACAGG + Intronic
1047421523 8:124711658-124711680 GGGTGGTATTACAATCCCTCTGG - Intronic
1047860991 8:128966526-128966548 TGGTTATAAAACAATCCCACTGG - Intergenic
1049077221 8:140408203-140408225 GGCAGGAAAATCAATGCCACAGG + Intronic
1055649633 9:78394770-78394792 GGGAGTAATAACAACCCCACAGG - Intergenic
1058100715 9:100915387-100915409 GAGTGGAAAAACCAAACCACTGG - Intergenic
1058619468 9:106867520-106867542 GGGGGAAAAAACAATTCCTCGGG - Intronic
1060265822 9:122110984-122111006 GGTTGGAAAAAGCAGCCCACAGG + Intergenic
1203746071 Un_GL000218v1:41272-41294 GGGTGGAAATGCAATCCTGCCGG + Intergenic
1203564040 Un_KI270744v1:78210-78232 GGGTGGAAATGCAATCCTGCCGG - Intergenic
1185627750 X:1494269-1494291 TGCTGGGAAAAAAATCCCACTGG + Intronic
1190411581 X:50141617-50141639 GGGAGAGGAAACAATCCCACAGG - Intergenic
1196134734 X:112196247-112196269 GAGTGAAAAAAAAATCCCAATGG - Intergenic
1201159396 Y:11156284-11156306 GGGTGGAAATGCAATCCTGCCGG + Intergenic
1201250322 Y:12051110-12051132 GGATGGAAAAAAAGACCCACAGG + Intergenic