ID: 1092053911

View in Genome Browser
Species Human (GRCh38)
Location 12:5493256-5493278
Sequence CAACAGAATGAGAGCGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 273}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092053908_1092053911 0 Left 1092053908 12:5493233-5493255 CCGGTGTTAAGCTTCTACTATGG 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG 0: 1
1: 0
2: 0
3: 18
4: 273
1092053906_1092053911 10 Left 1092053906 12:5493223-5493245 CCACCGGAGTCCGGTGTTAAGCT 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG 0: 1
1: 0
2: 0
3: 18
4: 273
1092053907_1092053911 7 Left 1092053907 12:5493226-5493248 CCGGAGTCCGGTGTTAAGCTTCT 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG 0: 1
1: 0
2: 0
3: 18
4: 273
1092053903_1092053911 21 Left 1092053903 12:5493212-5493234 CCACCAGGACGCCACCGGAGTCC 0: 1
1: 0
2: 1
3: 7
4: 71
Right 1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG 0: 1
1: 0
2: 0
3: 18
4: 273
1092053905_1092053911 18 Left 1092053905 12:5493215-5493237 CCAGGACGCCACCGGAGTCCGGT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG 0: 1
1: 0
2: 0
3: 18
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092053911 Original CRISPR CAACAGAATGAGAGCGTGGA TGG Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901366076 1:8749766-8749788 CAGCAGAATGAGAATCTGGAGGG + Intronic
901502431 1:9661406-9661428 CAACAGAATGAGACCCTATAAGG - Intronic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903407459 1:23110153-23110175 CAACAAAATGAGAGCCAGCATGG - Intronic
903910858 1:26723830-26723852 CAACAGTATGAGAGCGCGAGTGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905726539 1:40257553-40257575 CAAGCGTATGAGAGAGTGGACGG - Intergenic
905832813 1:41086948-41086970 CAACAGAATGTGAGAGCTGAGGG + Intronic
905973199 1:42156151-42156173 AGACAGAAGGAGAGAGTGGAGGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908686659 1:66728068-66728090 CAATGGGATGATAGCGTGGAAGG - Intronic
908701515 1:66907404-66907426 GAAGAGAATGAGAGAGTTGAAGG - Intronic
909208571 1:72792442-72792464 TAACTGAATGAGGGAGTGGATGG + Intergenic
909344668 1:74571709-74571731 CAAAAGAATGAGGGCATGGGAGG - Exonic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915186797 1:154112834-154112856 CAACAGAATGAGACCCTGTCTGG + Intronic
919003043 1:191859620-191859642 AAACAGAAGGAGAGAGAGGAAGG - Intergenic
921130986 1:212219787-212219809 CAACACAGTGAGAGGGTGGGAGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922535016 1:226373217-226373239 CAGCAGAACGTGAGCGTGAAGGG + Intronic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923069433 1:230549263-230549285 CCACAGAATGAGGGTGAGGAGGG + Intergenic
923103064 1:230832655-230832677 GAACAAAATGAGGGGGTGGAGGG + Intergenic
924836373 1:247651817-247651839 CAACAGAGAGAGAGCGGGGAGGG - Intergenic
1062772792 10:116496-116518 CAACAGCTTGAGAGGGTGGAGGG - Intergenic
1062844465 10:693145-693167 GAGCAGAATGAGACCGAGGAAGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063298745 10:4832851-4832873 CTACATAATGAGAGTGTGGAAGG + Intronic
1063718817 10:8557579-8557601 TAAAAGAATGGGAGGGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1066302327 10:34107990-34108012 CCACAGAAAGAGAAGGTGGATGG + Intergenic
1068693397 10:59941058-59941080 CAAGAGAAAGAGTGCGTGGTGGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070729338 10:78814480-78814502 AAAAAAAATGAGAGTGTGGAGGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1074914136 10:117939368-117939390 CAACAGCATAAGAGAGTGGTTGG - Intergenic
1077062152 11:622174-622196 CAACTGAATGAGCGAGTGGACGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1080877769 11:36292319-36292341 CAATATAATGAGTGAGTGGAAGG + Intergenic
1081603390 11:44511139-44511161 TAACAGAATGGGTGGGTGGAGGG - Intergenic
1081807363 11:45897817-45897839 CAACAGAATGACAGCTTCCAGGG + Intronic
1082169116 11:48980905-48980927 CAACAGAATCAGATGCTGGAAGG - Intergenic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1085002708 11:73055081-73055103 CAAGAGAATGAGTGCCAGGAGGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085837192 11:79969698-79969720 CAAATGAATGAGAGGGTGGAAGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087986998 11:104694972-104694994 CACAAGAATGAGATCATGGAAGG - Intergenic
1088042285 11:105401843-105401865 CAACAAAAAGAGAGAGTTGAAGG - Intergenic
1090488041 11:127132269-127132291 AAACAGAAAAAGAGAGTGGAAGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091029177 11:132169041-132169063 CAAAAGAAGGAGGGGGTGGATGG - Intronic
1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092600999 12:10064470-10064492 CAACAGATTCAGAGCCTGGCAGG - Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096265630 12:50120296-50120318 CAACAGGACTAGAGCGTTGATGG + Exonic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1100389643 12:94137342-94137364 CAACAGGAGGAGGGAGTGGAAGG - Intergenic
1100855477 12:98753724-98753746 CATCAGAATGAAAACTTGGATGG - Intronic
1102515134 12:113441293-113441315 CAACAGCACGAGACCGTGGGTGG - Intergenic
1102670492 12:114614905-114614927 CTCCAGAATGAGAGCAGGGAGGG - Intergenic
1103497135 12:121371526-121371548 CAACAGAGAGAGAGAGAGGAAGG - Intronic
1104113136 12:125723011-125723033 CAACTGAATGAGAGAATGCAAGG - Intergenic
1104198580 12:126565748-126565770 CTACAGAATGAGAGGGAGAAAGG - Intergenic
1109011547 13:56954296-56954318 AAACTGAATTAGAGCCTGGAGGG + Intergenic
1113460281 13:110477916-110477938 TTACAGAATGAGTGTGTGGAGGG + Intronic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115310980 14:31977765-31977787 CAAAAGAATGAAAGAGAGGATGG - Intergenic
1115573977 14:34693352-34693374 GCACAGAATGAGGGCGTGGCAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1118816302 14:69316651-69316673 CCACAGAAAGAGAGTGTGGCTGG + Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1120432095 14:84432187-84432209 CAAGAGAATGAGACCGTAGATGG - Intergenic
1121494658 14:94383860-94383882 CAACAGCTAGAGAGCATGGAGGG + Intronic
1121564380 14:94897763-94897785 TTGCAGAATGAGAGAGTGGAGGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123911112 15:24967786-24967808 CAACAGAATGAGACCCTGTCTGG + Intronic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1125620327 15:41055400-41055422 CAATAAAATGACAGCGTGTAAGG + Intronic
1125707626 15:41753597-41753619 CCACAAAATGAGAGCTTGTAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127742229 15:61921975-61921997 CCACTGATTGAGAGAGTGGAGGG - Exonic
1128391476 15:67185554-67185576 CAACAGCATGAGGCCGTGGAAGG + Intronic
1131153282 15:90060028-90060050 CAACAGAGCAAGAGCGGGGAGGG - Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1134207213 16:12248055-12248077 CACCAGAATGAAAGCAGGGAGGG - Intronic
1134872780 16:17666871-17666893 CAACAGAAGGAGAGGGGGAAAGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137581570 16:49636686-49636708 CAGCAGGATGATGGCGTGGAAGG + Exonic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139617478 16:68107065-68107087 AAAAAGAATGAGATCATGGATGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143246300 17:5488307-5488329 GAACAGAAAGAGAGGGTGGAGGG + Exonic
1144039282 17:11394195-11394217 CTACAGAATGAGTGGATGGATGG + Intronic
1144326833 17:14190541-14190563 CAACAGAATGAGAATTTTGATGG - Intronic
1144517551 17:15929101-15929123 TAGCAGAGTGAGAGAGTGGAGGG + Intergenic
1145989857 17:29072796-29072818 CTACAGAATGAGAAGGTAGAAGG + Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146862680 17:36318154-36318176 CAACAGAATGAGACCCTGTCTGG + Intronic
1147093008 17:38122250-38122272 CAACAGAATGAGACCCTGTCTGG + Intergenic
1147104200 17:38198238-38198260 CAACAGAATGAGACCCTGTCTGG - Intergenic
1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG + Intronic
1148425293 17:47590175-47590197 CAACAGAATGAGACCCTGTCTGG + Intronic
1149878436 17:60262966-60262988 CAACAGAATGAGAACTTGTCTGG - Intronic
1149968836 17:61195377-61195399 CAACAGAATGAGACCTTGTCTGG - Intronic
1150115404 17:62544368-62544390 AAAGAGAATGAGAGAGTGAAGGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152277936 17:79369025-79369047 CCACACAAGGAGAGCGAGGAGGG + Intronic
1154091666 18:11369705-11369727 CAAAAGAGAGAGAGCGTGAAGGG + Intergenic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1155266899 18:24103080-24103102 CAACAGAGTGAGACCGTGTCTGG + Intronic
1156654649 18:39271026-39271048 CAACTGTATGAGAGCTGGGAAGG - Intergenic
1158701480 18:59752328-59752350 TTACAGAATGAGACCCTGGAAGG - Intergenic
1162180755 19:8867237-8867259 CAAGAGGATGAGTGGGTGGATGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163000215 19:14362475-14362497 CAACAAAGTGAGACCGGGGAAGG + Intergenic
1163345115 19:16736228-16736250 CAAAAGAAAGAGAGAGAGGAAGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929229082 2:39540686-39540708 CAACAGATTGGGAGTGTAGAAGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930525972 2:52530108-52530130 CAACAGAATGAGACCCTGTCTGG - Intergenic
931231096 2:60375455-60375477 CCACAGAATGAGAGGGAGGTGGG + Intergenic
932429572 2:71666044-71666066 AAACAGAATGAGAAGGAGGAGGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935998298 2:108798069-108798091 CAACAAGATGAGGGAGTGGAGGG + Intronic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940005016 2:149002298-149002320 AGACTGAAAGAGAGCGTGGATGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942042397 2:172079468-172079490 TAACAGAATTAGAGGTTGGATGG - Intronic
943539008 2:189188056-189188078 CAGCAGAATGAGAGGGTGAGTGG - Intergenic
943685474 2:190813226-190813248 CAACAGCAGGAGAGTGAGGATGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
947158004 2:227183273-227183295 CCCCAGAATGAGAGTGTGGGAGG - Intronic
948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG + Intronic
948700198 2:239754864-239754886 CAAAAGAATGAGTGAGTGGATGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1170476004 20:16715153-16715175 CAGAAGAATGAGAGACTGGAAGG - Intergenic
1170981835 20:21221532-21221554 CAAAAGAATGAGAGTCTGAATGG - Intronic
1172551661 20:35805216-35805238 CAACAGAATGAGACCTTGTCTGG - Intronic
1176975116 21:15312245-15312267 CAGGAGAGAGAGAGCGTGGAGGG - Intergenic
1178758129 21:35372614-35372636 CCACACCATGAGAGCCTGGAAGG + Intronic
1181147700 22:20860335-20860357 CAACAGACCGAGATCCTGGAGGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181903384 22:26173436-26173458 AAACAGCATGAGAGTTTGGAAGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183072692 22:35407374-35407396 AAACAGACTGAGGGGGTGGAGGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184747671 22:46465469-46465491 CCCCAGAATGAGAGGGAGGAGGG - Intronic
950173389 3:10854586-10854608 TAACAGCATGAGACCCTGGAAGG - Intronic
950308718 3:11937180-11937202 CAACAGAATGAGACCCTGTCTGG - Intergenic
950976981 3:17257005-17257027 GAAGAGAAGGAGAGAGTGGAAGG + Intronic
951991497 3:28680098-28680120 CAAGAAAATGAGAGAGGGGAGGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
956615716 3:71170286-71170308 CAACGGAGTGAGGGCGTGGGGGG - Intronic
956977398 3:74597075-74597097 CAACTTAATGAGAGGGGGGAAGG + Intergenic
958180852 3:90059030-90059052 AAGCAGGATGAGAGAGTGGAAGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961072614 3:123948893-123948915 CACCAGAATGAGAGGGAGCATGG + Exonic
961523295 3:127480635-127480657 CAACAGAAAGTGGGTGTGGAGGG + Intergenic
961651948 3:128421167-128421189 CAACAGAGTGTGGGCCTGGAGGG - Intergenic
961810881 3:129521070-129521092 CAACAGCTTGAGGGCATGGAAGG + Intergenic
962155118 3:132938271-132938293 CCACTGATTGAGAGGGTGGATGG + Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965207462 3:165740798-165740820 CAATTGACTGAGAGCCTGGATGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968107644 3:196013911-196013933 CAACACAAGGAGAGCCAGGATGG + Intergenic
968480156 4:829688-829710 CAGGAAAATGACAGCGTGGATGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
974368895 4:60988443-60988465 CAATAGAATGATAGGGTTGAGGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976222587 4:82769788-82769810 CTACAGAGTGAGAGGGAGGAAGG + Intronic
978398203 4:108305063-108305085 GAACAGATCGAGACCGTGGATGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978533684 4:109738835-109738857 CAACAGCATGAGAGACTGGAAGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979347899 4:119610712-119610734 CAACTGAATGTGAGAGTTGAAGG - Intronic
979715253 4:123829892-123829914 CTACAGAATGAGAGCCAGGTTGG + Intergenic
980972391 4:139579128-139579150 CAACAGAATGAGATCCTGAAAGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983625776 4:169800564-169800586 CAACAAAATGAGAGTGGGGATGG - Intergenic
984718912 4:182952281-182952303 CAATAGAGGGAGAGCGTGGCAGG - Intergenic
984763572 4:183383052-183383074 CAGCAGAATCAGAGGATGGAGGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984909270 4:184656936-184656958 CCACAGAATGAGAGCAAGGCTGG - Intronic
986751881 5:10794816-10794838 CATCAGAGTGAGAGGGTGCAGGG - Intergenic
989363199 5:40626613-40626635 CAACAGAATGAGAGAGTTTGCGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989664759 5:43841123-43841145 CATTAGAATGTGAGCTTGGAGGG + Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991580626 5:68151338-68151360 CAACAGAATGCTATTGTGGAGGG + Intergenic
992156609 5:73961230-73961252 CAACAGAATGACAGCAATGAAGG - Intergenic
993552486 5:89291095-89291117 CAACAGAATGTGCGGGAGGAGGG - Intergenic
994045659 5:95306544-95306566 CAACACAAAGACAGTGTGGATGG + Intergenic
994061549 5:95484364-95484386 CAACAGAATGAGATCCTGTCTGG - Intronic
995530883 5:113090979-113091001 GCACAGAATGAGAGCGTGGGAGG + Intronic
996413101 5:123180339-123180361 TAAGAGAAAGAGAGGGTGGAGGG - Intronic
997152380 5:131512125-131512147 CAACAGAAACAGAGCATGCAGGG + Intronic
997645143 5:135477029-135477051 CAAGAGAAGGAGAGAGGGGAGGG - Intergenic
1004278148 6:14256266-14256288 GAACTGAATGAGACAGTGGAAGG + Intergenic
1004801028 6:19148102-19148124 CAACAGATTGTAAGCGTGTAGGG - Intergenic
1006921124 6:37627857-37627879 CAAAAGAAGGAGAGGGTGAAAGG + Intergenic
1007322307 6:41036426-41036448 CAACAAATTGAGAAGGTGGAAGG + Intronic
1007405529 6:41634031-41634053 CAACACAATGAGACAGAGGAGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1010189699 6:73182521-73182543 CTACAGGATGAGGGGGTGGAGGG - Intronic
1010457226 6:76070812-76070834 CAAAAAGATGAGAGAGTGGAAGG + Intronic
1013564423 6:111342859-111342881 CAGCAAAATGAGAGGCTGGAAGG + Intronic
1015135688 6:129867321-129867343 CAACAGAAAGAGAACCAGGAGGG + Intergenic
1016879634 6:148898207-148898229 AAAAAAAATGAGAGGGTGGAAGG - Intronic
1018037315 6:159892536-159892558 CAACTGAATGGGAATGTGGAAGG + Intergenic
1018735206 6:166682567-166682589 GAACAGAGTGAGAGGGAGGAGGG + Intronic
1019007655 6:168815276-168815298 CAACAGAATAACAGGGTGGTGGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020543617 7:9493856-9493878 AAACAGAATGACAGCCTGCATGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022311696 7:29202467-29202489 CAACAAAATGGGAAGGTGGAAGG + Intronic
1023597920 7:41852332-41852354 CAAGAGCATGAGATCATGGAGGG - Intergenic
1023706184 7:42943960-42943982 CAAGAGCAAGAGAGCGAGGAGGG - Intronic
1024147563 7:46532881-46532903 CTCCAGAAAGAGAGTGTGGAGGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1027223645 7:76230627-76230649 CAACAGATTGAGAGTCAGGAAGG + Intronic
1027665185 7:81035868-81035890 CAACAGGATGAGAACGTTCAGGG + Intergenic
1031060750 7:117048787-117048809 GAACATAATGAAAGTGTGGAAGG - Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1037233748 8:16691463-16691485 CAGCAGAATGTGAGCGGGCAAGG - Intergenic
1038507325 8:28095842-28095864 AAACATAATGAAAGCGTGGATGG - Intronic
1038537332 8:28362659-28362681 CCACAGAAAGAGAGCCTGGGGGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039582067 8:38675091-38675113 CAAAGGAATGAGGGCATGGAAGG - Intergenic
1039781297 8:40788950-40788972 CTACAGAAAGAGAGAGAGGAAGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040770548 8:50970129-50970151 CCACAGAATGAGAAGGGGGAAGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1045002737 8:97892734-97892756 CAAGAGAATGAGAGTATGAAAGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046495507 8:115009393-115009415 CAAGAGAAAGAGAGAGTGAAAGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047167217 8:122452495-122452517 GAACAGAGCGAGAGAGTGGAAGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051837931 9:21362008-21362030 CAGCAGCCTGAGAACGTGGAAGG - Intergenic
1051845799 9:21449785-21449807 CAGCAGCCTGAGAACGTGGAAGG + Intergenic
1053035482 9:34823871-34823893 CACCAGACTGAGATCCTGGAAGG + Intergenic
1053039846 9:34861154-34861176 TAACAGAATGAGACCCTGTAAGG + Intergenic
1053301092 9:36950103-36950125 CATCAGGATGAGAGCATGCAAGG - Intronic
1053330434 9:37201346-37201368 GAAAAGAATGAGAAGGTGGAAGG - Intronic
1055332861 9:75202131-75202153 CTACAGAATCAGAGTCTGGAGGG + Intergenic
1055891667 9:81130577-81130599 AAACAGAATGACAGCAAGGAGGG + Intergenic
1056517620 9:87370500-87370522 GGACAGAAGGAGAGCGTGGGTGG + Intergenic
1059888705 9:118776590-118776612 CAACAGAAAGAGAGCAGGCATGG - Intergenic
1060035575 9:120252767-120252789 CAACAGAATGCCAGTGTGGCTGG + Intergenic
1060984976 9:127814751-127814773 CCCCAGAGTGAGAGTGTGGATGG + Intergenic
1203782740 EBV:109812-109834 CAAGAGAATGACAGCAAGGACGG - Intergenic
1185616033 X:1422585-1422607 CCACAGAATGGGAGGCTGGAAGG + Intronic
1187075823 X:15933468-15933490 AAAAAGAATGAGAGAGTAGATGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188852307 X:35146884-35146906 CAACACAAAGAGAGGTTGGAAGG + Intergenic
1188995366 X:36878548-36878570 CAACAGAAGGAGAGCGTCTATGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190667511 X:52708564-52708586 CAACAGAAAAATAGCGTGGGCGG - Intergenic
1190671907 X:52749844-52749866 CAACAGAAAAATAGCGTGGGCGG + Intergenic
1190937384 X:55008912-55008934 AAACAGAATGAGAAAGAGGAAGG - Exonic