ID: 1092054812

View in Genome Browser
Species Human (GRCh38)
Location 12:5500039-5500061
Sequence CAGCCTAAACAGAAGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092054808_1092054812 -8 Left 1092054808 12:5500024-5500046 CCAGCAGACTCCAAGCAGCCTAA 0: 1
1: 0
2: 2
3: 18
4: 170
Right 1092054812 12:5500039-5500061 CAGCCTAAACAGAAGGAGCCGGG 0: 1
1: 0
2: 0
3: 19
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092054812 Original CRISPR CAGCCTAAACAGAAGGAGCC GGG Intronic
900750721 1:4395475-4395497 CAGCCTGAACAGAAGAAGACAGG + Intergenic
903957466 1:27035235-27035257 AAGCTGAAACACAAGGAGCCGGG - Intergenic
905540960 1:38760125-38760147 CAGCCTTAGCAGAAAGAGGCTGG - Intergenic
906356313 1:45108533-45108555 CAGTCTCAAGAGAAGTAGCCAGG - Intronic
906713777 1:47952116-47952138 CAGCCTCACCTAAAGGAGCCAGG + Intronic
912131699 1:106610496-106610518 CAGCCAAAACAGAAGCAACTGGG + Intergenic
912550240 1:110480699-110480721 CAGCCTTTATAGAGGGAGCCAGG - Intergenic
912601210 1:110934772-110934794 CAACCTAAAGGGAAGGAGGCGGG + Intergenic
912719439 1:112007179-112007201 CAGCCCAAAAAGAGGGAGACTGG + Intergenic
913441512 1:118903171-118903193 AAGCCTAAAGAGAAGAGGCCTGG - Intronic
915664652 1:157433477-157433499 CAGCCCAAAAAGCAGCAGCCTGG - Intergenic
915902006 1:159854416-159854438 CAGCCTAAGCAGAGGGCCCCGGG - Exonic
916142997 1:161715799-161715821 CAGGCTAGACAGAAAGAGACGGG - Intergenic
916741619 1:167651380-167651402 CAGGCATGACAGAAGGAGCCAGG - Intronic
917545109 1:175957892-175957914 CATGCTAAATAAAAGGAGCCAGG + Intronic
918104231 1:181402643-181402665 CTGCATAAAGACAAGGAGCCAGG + Intergenic
918782256 1:188715920-188715942 CAGCCTCAACAGCAGGGACCTGG + Intergenic
919360269 1:196584033-196584055 CAGCCTAACAAGAGGGTGCCAGG + Intronic
920435848 1:205946628-205946650 CAGCGGACAGAGAAGGAGCCGGG + Intergenic
921361890 1:214337699-214337721 CAGCCTAGACAGCAGCAACCTGG + Intergenic
923828603 1:237527961-237527983 CAGCCTATACAGCATGGGCCAGG - Intronic
1062798570 10:362489-362511 AAGCCTCGACAGAAGCAGCCAGG - Exonic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1066501984 10:36003480-36003502 TTGCCTGAACAGAATGAGCCTGG - Intergenic
1067844915 10:49711960-49711982 GAACCTAAACAAAAGAAGCCGGG - Intergenic
1068201315 10:53787566-53787588 CAGCATGAACAAAAGAAGCCTGG - Intergenic
1068524762 10:58115913-58115935 CAGCCTGAACAGACTGAGACAGG - Intergenic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070384149 10:75908831-75908853 CAAACAAAATAGAAGGAGCCTGG + Intronic
1070758926 10:79011131-79011153 CATACGACACAGAAGGAGCCTGG - Intergenic
1070794024 10:79206621-79206643 CTGCCTTTGCAGAAGGAGCCAGG + Intronic
1070955568 10:80461216-80461238 CAGCCTCAAGAAAAGGAGGCAGG - Intronic
1071305356 10:84294687-84294709 CAGCCCAAACAGAAGGGGACAGG + Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1072021671 10:91409652-91409674 CAGCCTACACAGGAAAAGCCTGG - Intergenic
1072929915 10:99653236-99653258 GATCCTAAAGAGAACGAGCCAGG - Intergenic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1075322579 10:121503974-121503996 CAGCCTTCTCAGATGGAGCCAGG - Intronic
1075579681 10:123607651-123607673 CAGCCGGAGCAGAAGGGGCCAGG - Intergenic
1076717277 10:132372655-132372677 CAGCCTACCCAGCAGGAGCCAGG + Intronic
1077261128 11:1621642-1621664 CAGCCTGAAGAGAAGCAGCAGGG + Exonic
1078423304 11:11229728-11229750 CAGCCTAATGAGATGGAGCAGGG - Intergenic
1082961347 11:58921391-58921413 GGGCCCAAAGAGAAGGAGCCCGG + Intronic
1083962433 11:66021727-66021749 CAGACTAAACACACGCAGCCTGG + Intronic
1085267607 11:75246531-75246553 CAGCCTGGACAGAAGGAACCCGG - Intergenic
1085402248 11:76241943-76241965 CAGCCAAGAAGGAAGGAGCCTGG - Intergenic
1086722121 11:90133981-90134003 CATGCTAAACCGAAGAAGCCAGG - Intronic
1088993091 11:114971485-114971507 CAGACTGAACAAAAGGAGCCAGG - Intergenic
1089194750 11:116687708-116687730 CAGCCTAAACAGTGGTACCCTGG - Intergenic
1092054812 12:5500039-5500061 CAGCCTAAACAGAAGGAGCCGGG + Intronic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1096862653 12:54541033-54541055 CAGCCAAAACAGAAAGACTCTGG - Intronic
1097316216 12:58173757-58173779 GAGGCTAAACAGAAGGGCCCTGG - Intergenic
1098192848 12:67968465-67968487 CAACATAGACAGAAGCAGCCAGG - Intergenic
1099086376 12:78251645-78251667 AAGCAGAAACAGAAGTAGCCTGG + Intergenic
1101062116 12:100983230-100983252 CAGCCTTAACAGTGGGAGCCTGG + Intronic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101838760 12:108312974-108312996 CAGCCTAGGCAGGAGGACCCTGG - Intronic
1101962018 12:109257864-109257886 CAATTTAAACTGAAGGAGCCGGG - Intronic
1103409539 12:120700995-120701017 GAGTATAAACACAAGGAGCCAGG + Exonic
1105300956 13:19134156-19134178 CTGCCTCAGCAGGAGGAGCCTGG + Intergenic
1110209225 13:72953030-72953052 CAGCCTTGACAGAAGCAGCTGGG + Intronic
1111942339 13:94624015-94624037 CAGCATAAGCAGCTGGAGCCAGG + Intronic
1112032869 13:95473520-95473542 CAGCCTAGACTGAAGGATCCTGG - Intronic
1112127266 13:96481723-96481745 CAGCTAAAAAAGAAGGAGCAGGG + Intronic
1112557818 13:100485107-100485129 CAGTCTAAACAGAGGGGGACAGG + Intronic
1112711901 13:102138712-102138734 CCTCCTGAACAGAAGGAGCTGGG + Intronic
1113217130 13:108055355-108055377 CACCATAAACGGAAGCAGCCTGG - Intergenic
1114149592 14:20022427-20022449 CAGTCACAACAGTAGGAGCCTGG + Intergenic
1114365993 14:22027482-22027504 CAGCCTTGACAGAAGCAGCTGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1119706004 14:76782979-76783001 CAGCCTACACAGCAGGAGCTGGG - Exonic
1121227003 14:92328453-92328475 CAGGCTACACAGAAGGACACCGG - Intronic
1121866046 14:97363880-97363902 CAGCCCTAAGAGACGGAGCCAGG + Intergenic
1123774582 15:23566009-23566031 CAGCCTCAGGAGGAGGAGCCTGG + Exonic
1124177351 15:27438861-27438883 CAGCCTCACCTGGAGGAGCCAGG + Intronic
1124496036 15:30187720-30187742 CAGCCTCAACAGCGGGAGCAGGG + Intergenic
1124747538 15:32350927-32350949 CAGCCTCAACAGCGGGAGCAGGG - Intergenic
1125714123 15:41809686-41809708 AAGCCTAAAGAGAAGCTGCCTGG + Intronic
1126886740 15:53158980-53159002 CAGTCTAGACTGAAGAAGCCTGG + Intergenic
1127671301 15:61197608-61197630 CAGCCTCACCTGACGGAGCCCGG - Intronic
1128343180 15:66836874-66836896 GACCCTGAACAGCAGGAGCCAGG - Intergenic
1128950422 15:71874408-71874430 TAGCTTAAACAGAAGGAACCAGG + Intronic
1129890446 15:79068233-79068255 CAGCGTGAACAGAAGGACCCTGG - Intronic
1131905689 15:97139526-97139548 CAGTGTAAACAGCAGGGGCCAGG - Intergenic
1134913375 16:18049395-18049417 AAGCCTAGACAGAATCAGCCAGG - Intergenic
1137459084 16:48641846-48641868 CAGTCAAAACAAAAGCAGCCTGG + Intergenic
1137948179 16:52755975-52755997 CAGAGTAACCAGGAGGAGCCAGG + Intergenic
1139239353 16:65375047-65375069 CAGCCTAATCACAATGAGCCAGG + Intergenic
1140362112 16:74353219-74353241 CAGCCAGAACAGGAGCAGCCTGG - Intergenic
1142108960 16:88321135-88321157 CAGCCTGGACAGGAGGAGCTTGG - Intergenic
1143654157 17:8283612-8283634 CAGCCTGAACAGGAAGAGCTAGG - Intergenic
1144082451 17:11776486-11776508 CTGCCTAAAGAGAAGGAGGTTGG + Intronic
1144471221 17:15543142-15543164 CAGCCAAGACAGCAAGAGCCTGG + Intronic
1147428179 17:40356187-40356209 CAGCTCCAACAGAAGCAGCCCGG + Exonic
1149620458 17:58041023-58041045 CAGCCTGAACTGAAGGAGAGGGG - Intergenic
1150215669 17:63467573-63467595 CAGAGTTAACAGAAGCAGCCGGG + Intergenic
1150716814 17:67579216-67579238 CTGCCCAAACAGAAAGAGCCTGG - Intronic
1151055767 17:71029698-71029720 CAGCCTAAACATAAGAAGTGAGG - Intergenic
1153565344 18:6413654-6413676 CAGCTCCAACAGAAGGATCCAGG + Intronic
1154102910 18:11492532-11492554 CAGCCTTGAGACAAGGAGCCCGG - Intergenic
1155100715 18:22607546-22607568 CAGCCTTGACACAAGGATCCAGG + Intergenic
1155125027 18:22865836-22865858 AAGCATAAACAGTAGGAGGCAGG - Intronic
1156031871 18:32722385-32722407 AAGCTTAACCAGAAGGAACCTGG + Intronic
1160301457 18:77684544-77684566 CAGACTAGACAGAGGGAGCAAGG + Intergenic
1160461508 18:79042194-79042216 CCGTCTAAACAGAAGGTGCAAGG - Intergenic
1160534459 18:79584787-79584809 CAGCCTGGGCAGAAGGGGCCGGG + Intergenic
1163230815 19:16000810-16000832 AGGCCTAATGAGAAGGAGCCTGG + Intergenic
1163328428 19:16620187-16620209 CAGCATAAACAGCTGGACCCAGG + Intronic
1165012913 19:32861857-32861879 CAGCCAAATCAGAGGCAGCCAGG - Intronic
1166365939 19:42278554-42278576 CAGCCAAAACAGAAAGAGGGTGG - Intronic
1166847416 19:45737468-45737490 CTGTCTAAAAAGAAAGAGCCAGG - Intronic
1167056387 19:47113503-47113525 CAGCCGAAAGAAAAGCAGCCAGG + Intronic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
927481150 2:23455132-23455154 CAGCTCTACCAGAAGGAGCCAGG - Intronic
928317828 2:30259438-30259460 CAGCCAAAACAGAACGAAGCGGG - Exonic
928422719 2:31151520-31151542 CAGCCAAAACGGAATGACCCTGG + Intronic
928756414 2:34531090-34531112 CAGCCTAAAGAAAGGGAGCATGG + Intergenic
928952336 2:36824181-36824203 CAGCACAAAAACAAGGAGCCAGG - Intergenic
929233518 2:39584047-39584069 CAGCCTCAGTAAAAGGAGCCTGG + Intergenic
931135566 2:59395731-59395753 CAGGCTTCACAGAAGGAGCCTGG - Intergenic
931486156 2:62694760-62694782 AAGCCAAAACAGAGGAAGCCAGG - Intronic
932499155 2:72166768-72166790 CAGCCTATACTGAAGGGGCAGGG - Intergenic
932749537 2:74362594-74362616 CAGCATAAACTGGTGGAGCCAGG - Intronic
934883097 2:98000368-98000390 CAGCTGAAACAGACCGAGCCTGG - Intergenic
935030622 2:99318184-99318206 CAAGCTCAACAGAAAGAGCCTGG - Intronic
936066730 2:109338026-109338048 CATCAAAAACAGAAGGAGCCTGG - Intronic
936687612 2:114846793-114846815 CAGCCTAATTGGAAGTAGCCAGG - Intronic
937126897 2:119480881-119480903 GAGCCCAAAAAGAAAGAGCCAGG + Intronic
937431716 2:121844206-121844228 CATCCCAAACAGAAATAGCCTGG - Intergenic
937955740 2:127420878-127420900 CAGCCTTTACAGCAGCAGCCAGG + Intronic
938069943 2:128303036-128303058 CAGTCTAAACCCCAGGAGCCAGG + Intronic
938107390 2:128542659-128542681 CAGCCCAGAAAGAAGGAGGCTGG - Intergenic
943446859 2:187996617-187996639 CAGCCTTGACAGAAACAGCCAGG - Intergenic
944342756 2:198622548-198622570 CAGCCTGAACTGAAGAACCCTGG - Intergenic
944686993 2:202126254-202126276 CAGCCCCAAAAGAAGCAGCCAGG - Intronic
948396162 2:237646872-237646894 CAGCCTAAGCAGACTGAGACAGG + Intronic
1171186337 20:23126677-23126699 CAGCCTAAACCCAAGGCCCCAGG - Intergenic
1171348460 20:24484503-24484525 CACCCTGAACAGAAGGAGTGTGG - Intronic
1173333911 20:42097994-42098016 CAGCCTGTACAGACAGAGCCTGG - Intronic
1174867589 20:54152266-54152288 CAGCCTGAACTGAAGGAGTGTGG + Intergenic
1175787077 20:61718437-61718459 CACCCAACACAGAAGGAGGCAGG + Exonic
1179959328 21:44759330-44759352 GAGCCTCAGCAGAAGGAGCCAGG - Intergenic
1181615231 22:24049714-24049736 CAGTCTTAACAAAAGGAGCCTGG - Intronic
1182651373 22:31853981-31854003 CAGCCTACACAGAAGCAGGAAGG - Intronic
1182941091 22:34278190-34278212 AAGCCTAAAGATAAGGAGCAGGG - Intergenic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1184538953 22:45107152-45107174 CAGCCTGAGCTGATGGAGCCAGG + Intergenic
1185118137 22:48949564-48949586 CAGCCTATAAGGAAGCAGCCCGG - Intergenic
951197260 3:19838364-19838386 CATCCAACACAGAAGCAGCCAGG + Intergenic
953436559 3:42881875-42881897 CAGGAAAAACAGAAGGAACCTGG - Intronic
954082663 3:48221699-48221721 CAGGCCAAACAGAAGGATCGGGG + Intergenic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
956458718 3:69450326-69450348 CAGCCTGAAAAGAATTAGCCAGG + Intronic
960446520 3:117756201-117756223 AAGCCTAAACAGAAAAAGCTTGG + Intergenic
962980797 3:140487713-140487735 CAGCCTAAACAGAGGGACAAGGG - Intronic
963265645 3:143237839-143237861 TGGCCTAAAGTGAAGGAGCCAGG - Intergenic
966054002 3:175659896-175659918 CAGCCTGAACAGACTGAGGCAGG - Intronic
967135421 3:186508937-186508959 CTGGCTAGACAGCAGGAGCCAGG + Intergenic
969461308 4:7330562-7330584 CATGCCAAGCAGAAGGAGCCAGG - Intronic
970735781 4:19165870-19165892 CAGACAAATCAGAAGGAGTCTGG + Intergenic
972794370 4:42400547-42400569 CAGTCTAAGCAAAGGGAGCCAGG - Intronic
974531293 4:63111041-63111063 GAGCAAAAACAGCAGGAGCCGGG + Intergenic
975307200 4:72864029-72864051 CATCCTAGACAGAAAGAGGCAGG + Intergenic
979632207 4:122916130-122916152 CAGCAAAAACAGAAACAGCCAGG + Intronic
980073755 4:128271071-128271093 CATCCTGAAAAGAAGGAGACAGG - Exonic
980481154 4:133389284-133389306 CAGACTGAACAGAGGTAGCCTGG + Intergenic
981229930 4:142340711-142340733 CAGGCTAACGAGAAGGACCCTGG - Intronic
984984712 4:185316751-185316773 CAGTATCAACAGAAAGAGCCAGG - Intronic
985088945 4:186343834-186343856 AAACATAAACAGAAGGGGCCGGG - Intergenic
986197626 5:5552617-5552639 CAGGCTAAAAAAAAGTAGCCAGG - Intergenic
986736147 5:10668805-10668827 ATGACTGAACAGAAGGAGCCTGG - Intergenic
987065355 5:14284912-14284934 CAGCCTAAGCAGGAAGAGGCAGG - Intronic
990702377 5:58488001-58488023 CAGCCTAGAAAGCAGAAGCCTGG - Intergenic
990988570 5:61662889-61662911 GATCCTAAAGAGAAGGACCCTGG - Intronic
991371935 5:65927158-65927180 CTTCCCAAACAGAAGGTGCCTGG - Intronic
991966240 5:72094299-72094321 CAGCCCAAACAGAAACAGCATGG - Intergenic
992447346 5:76845949-76845971 CAGCCACTACAGCAGGAGCCTGG + Intergenic
996349330 5:122520966-122520988 TTGCCTAATCAGAAGGAGGCAGG + Intergenic
998012554 5:138707172-138707194 TAGCCTGAAGAAAAGGAGCCAGG + Intronic
998075139 5:139230071-139230093 CAGCCTACACTGAAGGAGTGGGG - Intronic
998701418 5:144704568-144704590 AAGCATAAACAAGAGGAGCCAGG + Intergenic
999035419 5:148343500-148343522 CAGCCAAAACAGAAGTAGGGTGG - Intergenic
999128076 5:149261365-149261387 CAGCCTCAACAGGGGGAACCAGG + Intergenic
999517393 5:152314874-152314896 CAGCCAAAGCAAAAGGAGTCGGG + Intergenic
999544587 5:152613225-152613247 CAACCCAAAACGAAGGAGCCAGG + Intergenic
1002431505 5:179206785-179206807 CAACCTAAGCAGGAGGTGCCAGG - Intronic
1002940924 6:1715088-1715110 CAGCAGAAACATAAGGAGACAGG + Intronic
1007193446 6:40039266-40039288 CAGCCTGATCAGAAGGACTCAGG + Intergenic
1019883062 7:3880420-3880442 TAGCCTCAGCAGCAGGAGCCCGG + Intronic
1022111241 7:27233484-27233506 GAGCCTAATGAGTAGGAGCCTGG + Intergenic
1022395524 7:29985103-29985125 CATCCTAAAAGGAAGGAGACTGG + Intronic
1023840216 7:44092891-44092913 CAGCTTTAACAGTAGGGGCCAGG + Intergenic
1024975361 7:55109251-55109273 CAACCTAAACAAAAGGGGTCTGG + Intronic
1033109698 7:138563167-138563189 GGGCCTAAGGAGAAGGAGCCTGG + Intronic
1034222425 7:149456839-149456861 CAGCCTCTACAGCAGGGGCCGGG - Intronic
1034325262 7:150224731-150224753 CAGCCTACACTGAAGGAGTGAGG + Intergenic
1034572249 7:151965580-151965602 CAGCGTTAACAGTAGGAGGCTGG + Intronic
1034767939 7:153744515-153744537 CAGCCTACACTGAAGGAGTGAGG - Intergenic
1034879709 7:154753762-154753784 CAGCCTAGACGGAAGGCGGCTGG - Intronic
1036571623 8:9984824-9984846 AAGACTCAACACAAGGAGCCAGG + Intergenic
1042191944 8:66195924-66195946 CAGACTATACTGAAGGAGACAGG + Intergenic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044929163 8:97235183-97235205 TAGCCTAGAGAGAAGGAGCAGGG - Intergenic
1046074899 8:109303023-109303045 AAGCCTAAACTGCAGGGGCCAGG + Intronic
1046284662 8:112079486-112079508 CAGCCTTGACAGAAGGGGCTTGG + Intergenic
1049022914 8:139970187-139970209 ATGCCCAAAGAGAAGGAGCCGGG + Intronic
1050106355 9:2170342-2170364 CAGCCTAGGAAGAAGGAGCCGGG + Intronic
1050440461 9:5656337-5656359 CATCCAAAACAGAAAGAACCAGG - Intronic
1050566536 9:6889888-6889910 CAGCCTAGAAAGAGGGTGCCAGG - Intronic
1051612425 9:18974175-18974197 CATTCAAAATAGAAGGAGCCAGG + Intronic
1052043588 9:23768996-23769018 CAGCCTAAACAGAGTGAACTTGG + Intronic
1052044432 9:23777954-23777976 CAACATAAACAGCAGCAGCCAGG + Intronic
1052666600 9:31502789-31502811 CAGCATCAACAGCAGGAGCAAGG + Intergenic
1052784191 9:32813620-32813642 CAGGCCAAACAGAAGGCGCTAGG - Intergenic
1055512854 9:77012368-77012390 AACCCAAAACAGAAGGAGCAGGG + Intergenic
1057464824 9:95303464-95303486 CAGCCTAAACTGACGAAGACAGG - Intronic
1058286770 9:103188446-103188468 CTGCCTAATTAGAAGGAGGCAGG - Intergenic
1059153219 9:111967500-111967522 CAGCCGACACAGAAGCAGCCAGG - Intergenic
1059453454 9:114385398-114385420 CTGCCATAACAGCAGGAGCCAGG - Intronic
1059541165 9:115131967-115131989 CAGCCTAGACAGAAGGTGGGTGG - Intergenic
1061919025 9:133772112-133772134 CAGCAAACACAGAATGAGCCTGG - Intronic
1062219967 9:135409844-135409866 CAGCCTAAACAGCCGGGGCAGGG - Intergenic
1186826702 X:13347395-13347417 TTGCCTTTACAGAAGGAGCCAGG + Intergenic
1190774770 X:53543950-53543972 GAGCCTAAACCGGAGGAACCTGG + Exonic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1196867998 X:120086726-120086748 GGGCCTAAAAAGATGGAGCCTGG + Intergenic
1196875105 X:120149555-120149577 GGGCCTAAAAAGATGGAGCCTGG - Intergenic
1198254032 X:134909425-134909447 CAGAGTAAACAGCAAGAGCCAGG - Intronic