ID: 1092056454

View in Genome Browser
Species Human (GRCh38)
Location 12:5511988-5512010
Sequence CTGTGTGCATGGGGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 1, 1: 2, 2: 9, 3: 75, 4: 706}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092056440_1092056454 17 Left 1092056440 12:5511948-5511970 CCTGTCCTTGAACAAGAGAGCAG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG 0: 1
1: 2
2: 9
3: 75
4: 706
1092056441_1092056454 12 Left 1092056441 12:5511953-5511975 CCTTGAACAAGAGAGCAGACAGT 0: 1
1: 0
2: 3
3: 21
4: 195
Right 1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG 0: 1
1: 2
2: 9
3: 75
4: 706

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092056454 Original CRISPR CTGTGTGCATGGGGGGAGGA GGG Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900520871 1:3104958-3104980 CTCAGTGCATGGGAGGAGGCAGG + Intronic
900745354 1:4356919-4356941 CTGAGTGCCCGAGGGGAGGAGGG - Intergenic
901025877 1:6278469-6278491 GCGTGGGCATGGGGGGAGTAGGG + Intronic
901666150 1:10827525-10827547 CTGGGACCATGGGGGAAGGAGGG - Intergenic
902603564 1:17556159-17556181 CTGGGAGCATTGGGGGAGGCTGG + Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
903450913 1:23453029-23453051 CTGTGTGAAAGGGGGCAGGAGGG + Intronic
903580308 1:24365811-24365833 CTGTGGGCCTGGGGGAAGGGAGG - Intronic
904035586 1:27557023-27557045 CTGTGTGGCTGGGGGTAGGGTGG - Intronic
904340396 1:29830409-29830431 CTGGGGACATGGGGGCAGGATGG - Intergenic
904770438 1:32878237-32878259 GTGTGTGTTTGGGAGGAGGAAGG + Intergenic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG + Intergenic
905770564 1:40635629-40635651 GTGTGTGCGTGGTGGGAGGTGGG + Intronic
905777611 1:40679291-40679313 TTGTGTGCCTGGGGAGGGGATGG - Intergenic
906103028 1:43275200-43275222 GTGTGTGCATGGCAGGGGGAAGG - Intergenic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906303789 1:44703349-44703371 CTGGGTGAATGGGGAGAGGGAGG - Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907869923 1:58433647-58433669 CTGTGTGGAGGGGGGGAGGCGGG + Intronic
907903452 1:58762693-58762715 CAGAGTACATGGGGGGAGGCCGG + Intergenic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
909195507 1:72616828-72616850 CTGTGTGTGTGCGGGGGGGAGGG - Intergenic
909263653 1:73527737-73527759 GTGTGTGCCTGTGGGGAGGGAGG - Intergenic
909344666 1:74571702-74571724 ATGAGGGCATGGGAGGAGGAAGG - Exonic
910490227 1:87761140-87761162 CTGTGTGCATGGGGGAAAGCAGG - Intergenic
910806118 1:91191230-91191252 GTGGGTGCATGGGGCGAGGGTGG - Intergenic
910904546 1:92161194-92161216 GTGTGTTCATGGGAGAAGGAGGG + Intergenic
910934486 1:92476208-92476230 CTGTGGGGATGGGAGGGGGAGGG + Intronic
911141125 1:94503677-94503699 CTGTTTGCATGAAGTGAGGAAGG - Intronic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
911971480 1:104443365-104443387 CTGTGTGAAAGGTGGGAGGGGGG - Intergenic
912075630 1:105872038-105872060 GTGTGTGTGTGGGGGGAGGTGGG + Intergenic
912245108 1:107953714-107953736 CTGGGAGCATGGGGGCAGCATGG - Intronic
912700291 1:111873223-111873245 CTGTGTGCATTGTGTGTGGAGGG + Intronic
913192608 1:116426286-116426308 GTGTGTGTATGTGGGGAGGTAGG + Intergenic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
914806312 1:150994752-150994774 CTGTGTGCAGGGAGTGAGGGTGG - Intronic
914997848 1:152560569-152560591 CTGTGTGGATGGGTAGAGGGTGG + Intronic
915311460 1:155007723-155007745 CTGGGAGCAGGGGGGTAGGAGGG + Intronic
915318915 1:155045377-155045399 CAGGGTGTATTGGGGGAGGATGG + Intronic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
916695516 1:167231993-167232015 GTGTGTGTGTTGGGGGAGGAGGG - Intronic
916697405 1:167253377-167253399 CTGTGTGTTTGGGGGGGGGGGGG - Intronic
917081560 1:171261298-171261320 CTGTGTGTGTTGGGGAAGGAGGG - Intronic
917562008 1:176168399-176168421 CTGGGTGGGTGGGGGGAGTACGG + Intronic
917710490 1:177679548-177679570 CTGTGTTCTTGGGGAGAGGGAGG - Intergenic
917930460 1:179819045-179819067 CTGTGTGCTGGGCTGGAGGATGG - Intergenic
918139103 1:181705231-181705253 ATGTGTGCCTGGAGGGATGAGGG - Intronic
918473380 1:184898130-184898152 CTGTGAGCAAGGGAGGAGGGAGG - Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920766069 1:208835130-208835152 CTGTGTGTGTGGGGAGAGGCAGG - Intergenic
921065606 1:211620433-211620455 CTGTGAGCGTGGGGGAAGTAGGG + Intergenic
921366981 1:214383523-214383545 CTCTGGCCATGGCGGGAGGAAGG + Exonic
922108492 1:222533426-222533448 ATGTGTGTATGGGGGCAGGGTGG + Intronic
922143467 1:222914585-222914607 CTCTGGGGATGGGAGGAGGAAGG - Intronic
922585630 1:226733097-226733119 CTGTGTGAGTGGGGTGAGCAAGG + Intronic
922742412 1:228021488-228021510 CCGTGAGCACGTGGGGAGGAGGG - Intronic
922976615 1:229789845-229789867 CTGTTTGCAGGGCAGGAGGAGGG + Intergenic
922978619 1:229805764-229805786 CTAAGTGCTTGGAGGGAGGAGGG + Intergenic
923362653 1:233226800-233226822 GTGTGGGCATGGGGAGAGGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923412647 1:233725406-233725428 CTGTTTGCACTGGGGGAGGCTGG - Intergenic
924638902 1:245814793-245814815 GTGTGTGCATGGTGGGATAAGGG - Intronic
924729220 1:246696800-246696822 CTGTGTGTGTGTGGTGAGGAGGG + Intergenic
1062833790 10:623448-623470 CTGTGGGGCTGAGGGGAGGAGGG + Intronic
1062901054 10:1147446-1147468 CGGTGTGTGTAGGGGGAGGAGGG + Intergenic
1062974357 10:1672556-1672578 GCGCGTGCATGGGGGGAGGCAGG - Intronic
1062974373 10:1672606-1672628 GTGTGTCCATGGAGGGAGGCAGG - Intronic
1062974411 10:1672742-1672764 GTGTGTGCGTGGAGGGAGGGAGG - Intronic
1063119223 10:3092961-3092983 ATGTGTGGATGGGGGTAGGGGGG + Intronic
1063205683 10:3828570-3828592 GTGTGTGCATGGGGTGAGGGAGG + Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063943752 10:11157381-11157403 GTGTGTGTGTGGGGGGAGGGCGG - Intronic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064873981 10:19971989-19972011 CGTTGTGCATAGAGGGAGGAAGG + Intronic
1065844349 10:29733152-29733174 CTCTCTGGATGAGGGGAGGAAGG + Intronic
1067616976 10:47763781-47763803 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1067743498 10:48914716-48914738 CTGGGTCCATGAGGGGAAGAGGG - Intronic
1067932362 10:50575604-50575626 CTTTGTGTGTGGGGGGAGGAGGG - Intronic
1068419985 10:56779033-56779055 CTGAAATCATGGGGGGAGGAGGG - Intergenic
1069244639 10:66188568-66188590 GTGTGTGTGTGGGGGGAGGGGGG + Intronic
1069852837 10:71421362-71421384 CTGTGTGCCTGGGGAGTGGGTGG + Intronic
1070322035 10:75361841-75361863 CTGTGTGCCTGGGCGTGGGAAGG + Intergenic
1071374662 10:84990447-84990469 GTGTGTGTTGGGGGGGAGGAGGG + Intergenic
1071415153 10:85434139-85434161 CTGTGTGGGTTGTGGGAGGATGG - Intergenic
1072271038 10:93776856-93776878 CTGTGTGCAAAGGAGGAGGTTGG + Intronic
1072728252 10:97828011-97828033 CAGTGAGCATCGCGGGAGGATGG + Intergenic
1072750548 10:97975398-97975420 CTGGCTGCATGGGGCGTGGAGGG + Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1073323317 10:102628554-102628576 CTTTGAGCTTGGGGGTAGGAGGG + Intronic
1073558569 10:104477857-104477879 ATGTGGGCATGTGGGAAGGATGG + Intergenic
1073585851 10:104709159-104709181 CTGTGTGTTTGGGAGGAGGCGGG + Intronic
1074343239 10:112655130-112655152 GGGTGTGTATGGGGGGTGGAGGG - Intronic
1074724875 10:116297633-116297655 CTGTGTGTTTGTGGAGAGGACGG + Intergenic
1074914747 10:117944565-117944587 CTGGGTGCAGGGGTGGATGAGGG + Intergenic
1075022025 10:118959158-118959180 CTATGTGTATGGGGGGTGGTGGG - Intergenic
1075406973 10:122201503-122201525 CTGTGTTCATATGGGGAGGACGG + Intronic
1075539791 10:123302509-123302531 GTGTGTGCATGGTGGGGGTAGGG + Intergenic
1075656597 10:124165816-124165838 CTGTCTGCAAGCCGGGAGGAGGG + Intergenic
1075790660 10:125082171-125082193 CAGGCTGCCTGGGGGGAGGAGGG - Intronic
1076015489 10:127024300-127024322 CAGTGTTCATGGCTGGAGGAAGG + Intronic
1076342680 10:129760249-129760271 CTGTGTGTGTGGGGGCAGAAAGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG + Intronic
1076602720 10:131669464-131669486 CTGTGTGCATGAGGGAGGCAAGG + Intergenic
1076670847 10:132120424-132120446 CTGTGGTCAGGGGTGGAGGAAGG - Intronic
1076886665 10:133266213-133266235 CTGAGTGCCTGGGGGGACCATGG + Intronic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077481816 11:2818566-2818588 CTGTGTGCGTGTGGGGATGGGGG - Intronic
1078050678 11:7962700-7962722 GTGGGTGCCTGGGGGGAGGGAGG - Intronic
1080009694 11:27445550-27445572 CTGTATTCGTTGGGGGAGGAGGG - Intronic
1080305999 11:30837043-30837065 ATGTGTGTTTGAGGGGAGGATGG + Intronic
1080395294 11:31884553-31884575 CTGTGTGTCTGTGGAGAGGAGGG + Intronic
1080479966 11:32637585-32637607 GTGTGTGTTTGGGGGCAGGAGGG - Intronic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1081665230 11:44912920-44912942 TTGTGTGCATGGGGGTTGGGGGG + Intronic
1081691316 11:45080439-45080461 CTGTAGGCAGGGGGTGAGGATGG - Intergenic
1082902686 11:58272792-58272814 CTGTGTGTCTGTGGAGAGGACGG + Intergenic
1083764641 11:64836050-64836072 CAGTGTGCCTGGAGGGAGCATGG - Intronic
1083776000 11:64894638-64894660 TTCTGTGTCTGGGGGGAGGAGGG - Exonic
1084084304 11:66847845-66847867 CTGTGGGCAGGTGGGCAGGAGGG + Intergenic
1084457940 11:69279165-69279187 CTGTGTGCATGGGTGGCTGGTGG - Intergenic
1084494050 11:69493988-69494010 CTGTGTTCATGGCGTGTGGAGGG + Intergenic
1084507016 11:69574725-69574747 CTGAGTGGATGGTGGGAGGGAGG - Intergenic
1084667808 11:70585894-70585916 ATGGATGGATGGGGGGAGGATGG - Intronic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1086352913 11:85961074-85961096 ATGTGTGTATGGGGGGTGGTGGG + Intronic
1087261368 11:96016253-96016275 ACGTGTACATGGGGGGAGGGTGG + Intronic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1088440564 11:109866282-109866304 CTTTGTGCTTAGGGAGAGGACGG - Intergenic
1088919976 11:114253676-114253698 GTGTCTTCATGGGGAGAGGAAGG - Intergenic
1089295571 11:117465183-117465205 CTGTGAGCATGGGGTGGGGGTGG + Intronic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089677836 11:120102202-120102224 CTGTGTGTATGAGTGGGGGATGG - Intergenic
1089778918 11:120859507-120859529 CTCTGTGTGTGGGGAGAGGATGG + Intronic
1089782161 11:120881311-120881333 CTGTGTACCTGGTGGGAGAAAGG - Intronic
1089829100 11:121309409-121309431 CTGTGTGCCTGGGAGGAAGGGGG + Intergenic
1090009132 11:123030410-123030432 CTTTTTAAATGGGGGGAGGAAGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090877254 11:130801723-130801745 CTGTCTGGGTGGGTGGAGGAAGG + Intergenic
1091299419 11:134498001-134498023 CTTGGTGCCTGGGTGGAGGACGG + Intergenic
1091642355 12:2246943-2246965 GTGTGTGCATGGGGGAAGAACGG - Intronic
1092016913 12:5167231-5167253 CTGTGGGCAAGGGTGGGGGATGG + Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092164858 12:6336528-6336550 CTCTTTGCATGGGGAGGGGATGG - Intronic
1093253703 12:16839695-16839717 CTGGGTGGAGGGTGGGAGGAGGG + Intergenic
1093711489 12:22334310-22334332 GTGTGTGCATGGGGGGCTGGCGG - Exonic
1094429413 12:30350317-30350339 CTGTGTGGGTGGGGGGGGGGCGG + Intergenic
1094763413 12:33561706-33561728 GTGTGGGCATGGTGGGATGATGG - Intergenic
1095205773 12:39439059-39439081 CTGAGTGCATGGGTGTAGGAAGG - Intronic
1095944845 12:47748028-47748050 TGGTGTGCATGGGGATAGGATGG - Intronic
1095962644 12:47845069-47845091 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1095975127 12:47935140-47935162 CTGAGGGCACGGGGGCAGGAGGG + Intronic
1096124169 12:49107503-49107525 CAGTGTGCATGGAGGTAGGAGGG - Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096532210 12:52249219-52249241 CTCTGGGCATGGGGGGAGGGAGG - Intronic
1096542112 12:52313723-52313745 GTGTATGCATGGGGGAAGGGTGG + Intergenic
1097145388 12:56936191-56936213 CTGTGTGCATGGGGTGGGGATGG - Intergenic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1097802966 12:63935070-63935092 CTGTGAACATCGGGAGAGGAGGG + Intronic
1097910988 12:64969000-64969022 GTGTCTGCTTTGGGGGAGGATGG + Intergenic
1098111476 12:67126526-67126548 CTGGGTGCCTAGGGAGAGGAAGG - Intergenic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098463685 12:70762945-70762967 CTGTTTGCAAGGGTGAAGGAGGG - Intronic
1098620635 12:72593663-72593685 CTGTCAGCAGGGTGGGAGGAGGG - Intronic
1098918022 12:76277156-76277178 CTGTGGGGAGGTGGGGAGGAAGG - Intergenic
1099523349 12:83690393-83690415 CTGTGTGCTTGAGGGAAAGATGG - Intergenic
1100428605 12:94510174-94510196 CTCTGTGCATGGCGTGAAGAAGG + Intergenic
1101065439 12:101015833-101015855 TTGTGTGCATGAGGGGATGGGGG + Intronic
1101581972 12:106049737-106049759 CTGTGTGCCAGGCTGGAGGATGG - Intergenic
1101955536 12:109209056-109209078 TTGAGTGCATGGGGTCAGGATGG + Intronic
1103331839 12:120159733-120159755 CTGAGTGCTTGTGGGGAGGTGGG - Intronic
1103558306 12:121779027-121779049 CCGTGTTCCTGGGGGAAGGAAGG + Exonic
1104064711 12:125297196-125297218 CAGGGTGGATGGGAGGAGGAGGG + Intronic
1104068659 12:125326658-125326680 CTGTCTGCACCGGGGGAGGTCGG + Exonic
1104088019 12:125493564-125493586 CTGTGTGCTTGGGGTGGGGGTGG + Intronic
1104259874 12:127172588-127172610 GAGTGTGCATGGGGGGATGGGGG + Intergenic
1104614010 12:130253666-130253688 GTGTGTGCTTGGGTGGAAGAGGG + Intergenic
1104728899 12:131094403-131094425 CTGTGGGCACCGGGGCAGGACGG + Intronic
1104961368 12:132489978-132490000 CTGCGTGAATGGGGCGGGGAGGG + Exonic
1105295168 13:19082604-19082626 ATGTATACATGGGGGGAGGGGGG - Intergenic
1105458995 13:20566824-20566846 CTGTGTGAAGGGGGCGGGGAGGG - Intergenic
1106270286 13:28146386-28146408 CTGGATCTATGGGGGGAGGAGGG - Intronic
1108495932 13:51025476-51025498 CTCTGTGCAAGGGTGGAGGCGGG - Intergenic
1108556724 13:51600691-51600713 GTCTGTGGATGGGGAGAGGAGGG + Intronic
1111256108 13:85670674-85670696 CTGTGTCCCTGGGAAGAGGATGG + Intergenic
1112146435 13:96705546-96705568 CTGAGTGCAAGGGAGGAAGAGGG - Intronic
1113293486 13:108931734-108931756 CTGTGTACATGGGGGTGGGTGGG + Intronic
1113788212 13:113014095-113014117 CTGGGAGCACGGGGGGAGCATGG - Intronic
1113824792 13:113243341-113243363 CTGCATGCATGGGTGGAGGAGGG + Intronic
1113902336 13:113804067-113804089 CTGTGTGAAGGTGGGGAGGGAGG + Intronic
1113971265 13:114192064-114192086 GTGGGTGGGTGGGGGGAGGAAGG + Intergenic
1114657213 14:24323282-24323304 CTGTGGGCTTGGGCTGAGGAAGG + Intronic
1114744750 14:25135395-25135417 CTGAGTTCATGATGGGAGGATGG + Intergenic
1115503843 14:34075278-34075300 CTGAGGGCTTGGGGGCAGGAGGG - Intronic
1115545683 14:34462879-34462901 GTGTGTGCATGGGTGGGGGAAGG - Intergenic
1115641238 14:35336920-35336942 CTGTGAGGAAGGGTGGAGGAGGG + Intergenic
1117270578 14:54139309-54139331 GTGTGTGCATGGAGGGAGAGTGG - Intergenic
1117460404 14:55939443-55939465 CTGTCTGTGTCGGGGGAGGAGGG + Intergenic
1117783428 14:59258077-59258099 CTGTGTGCTTTGGGGAAGGCAGG - Intronic
1118807472 14:69250574-69250596 CTGTGTGCAGCTGGGGAGGCAGG + Intergenic
1119199827 14:72744106-72744128 CTGTCTGCATGGGGATAGGAAGG - Intronic
1119383774 14:74244662-74244684 CTCTGTGCTTGGGAGGAAGAGGG + Intronic
1119482120 14:74964468-74964490 CTGTGTGCAGGGGAGGGGAAGGG + Intergenic
1119871975 14:78025829-78025851 GTGTGTGTGTTGGGGGAGGAGGG + Intergenic
1119882858 14:78114806-78114828 CTGAGTGGATGAGGGCAGGAGGG - Intergenic
1120074615 14:80141306-80141328 CTGTGTTCATGAGGGCAGCATGG - Intergenic
1120161418 14:81149310-81149332 CTGTGTGCATGGGAGTGGGGAGG - Intergenic
1120452203 14:84682693-84682715 CAGTGTGGAAGGTGGGAGGAGGG - Intergenic
1120467848 14:84884525-84884547 CTGTGTGCTTGGGGAAGGGAAGG + Intergenic
1121527684 14:94630752-94630774 CTGGGTACCTGGGGAGAGGATGG - Intergenic
1121946910 14:98131895-98131917 GTGTGTGCATGGGGAGAGAGGGG + Intergenic
1121994890 14:98593968-98593990 CTCTGTGCATTTGGGAAGGAAGG + Intergenic
1122121420 14:99555466-99555488 CTGTGTGCCAGGGAGGAGAAGGG - Intronic
1122122056 14:99560036-99560058 CTGTGTGCAGGGGGTGAGTGGGG - Intronic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122793709 14:104195252-104195274 CTGGGGGCATGGGGTGAGGCAGG + Intergenic
1123059664 14:105588791-105588813 CTGTGTGCATGGGGTAGGGGTGG + Intergenic
1123083988 14:105709040-105709062 CTGTGTGCATGGGGTAGGGGTGG + Intergenic
1123134048 14:106011324-106011346 CTGTGTGCATGTGGAGAGAGAGG + Intergenic
1123165743 14:106323693-106323715 CTGTGTGCATGTGGAGAGAGAGG + Intergenic
1123404114 15:20010254-20010276 CTGTGTGCAGGTGGGGAGTGGGG + Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123513452 15:21016900-21016922 CTGTGTGCAGGTGGGGAGTGGGG + Intergenic
1123584077 15:21741764-21741786 CTGTGTGCATGTGGAGAGAGAGG + Intergenic
1123620727 15:22184367-22184389 CTGTGTGCATGTGGAGAGAGAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1123800343 15:23812353-23812375 GTTTGTGCGTGGGGAGAGGAGGG + Intergenic
1124400731 15:29345502-29345524 CTGTGTGCAGGGGGCCAGGTGGG - Intronic
1125430105 15:39585089-39585111 TTATGTGTTTGGGGGGAGGAAGG - Intronic
1125832912 15:42729119-42729141 AGCTGTGCCTGGGGGGAGGAGGG + Exonic
1127304140 15:57685502-57685524 CTGTGTGTGTCGGGGGAGGGTGG + Intronic
1127425328 15:58850213-58850235 GTGTGTACATGGGAGGAGGGAGG + Intronic
1127485290 15:59412805-59412827 CTCTGGGCATCGGGGTAGGAAGG + Intronic
1128080910 15:64856403-64856425 CTATGTGGATGTGGGGTGGAGGG + Intronic
1128724983 15:69981900-69981922 CTGTGGGCAGGTGGGCAGGATGG - Intergenic
1128762639 15:70227925-70227947 CAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1129184555 15:73897956-73897978 GTGTGTGCTGGGGGGCAGGAAGG - Intergenic
1129364701 15:75047177-75047199 CTGTGTGCAGGGCAGGAGCAAGG - Intronic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1129881057 15:79006151-79006173 CTCCGGGCATGGGAGGAGGAGGG + Intronic
1129897039 15:79116151-79116173 CAGTGCGTATGGGGGGAGGGGGG - Intergenic
1130348459 15:83069249-83069271 CTCTGGGCGTGGGGGCAGGAGGG + Intergenic
1130561878 15:84965226-84965248 TTCTGTACATGGTGGGAGGAAGG - Intergenic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1131189213 15:90300722-90300744 ATGTGTACATGGGGGAAGGGGGG - Intronic
1132157075 15:99503130-99503152 CCATCTGCTTGGGGGGAGGAGGG + Intergenic
1132481242 16:167189-167211 AAGTGTCCATGGGGGAAGGAAGG - Intergenic
1132602686 16:780947-780969 CTGTGTGCATGGGGAGGTGACGG + Intronic
1132855468 16:2042844-2042866 CTGGGAGGATGGGGGGAGGGTGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132891251 16:2205825-2205847 CCGTGTGCGTGGGGCGGGGATGG + Intronic
1133183935 16:4081689-4081711 CAGGGTGCAGGAGGGGAGGAGGG + Intronic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1133467202 16:6039090-6039112 CTGTGTGCATAGCGGGGAGAAGG + Intronic
1134063011 16:11210394-11210416 TTGTGGGCACGAGGGGAGGAAGG - Intergenic
1134098038 16:11432138-11432160 ATGTGTGCATGGGCTGAGGACGG - Intronic
1134353422 16:13459323-13459345 CTGGTGACATGGGGGGAGGAGGG + Intergenic
1134382215 16:13738567-13738589 CTATATGCAAGGGGGGAGAATGG - Intergenic
1134631258 16:15757728-15757750 CTATGTGCATGGGGAGAGTGTGG + Intronic
1134894573 16:17873112-17873134 GTGAGTGCATGGGGAGAGGCAGG - Intergenic
1135304193 16:21354724-21354746 CTGTGGGCATGGGGGTGGGGAGG - Intergenic
1135951013 16:26914116-26914138 CTGAGTGAATGGTGGGAGAACGG + Intergenic
1135964535 16:27024866-27024888 CTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1136300934 16:29333861-29333883 CTGTGGGCATGGGGGTGGGGAGG - Intergenic
1136560576 16:31036866-31036888 CAGTGTGGATGGGCAGAGGAAGG + Intronic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1138248919 16:55487699-55487721 TTGGGTGGATGAGGGGAGGATGG + Intronic
1138595704 16:58027861-58027883 CTGTGTGAATGGGGTGGGGGAGG - Intronic
1139527300 16:67524863-67524885 GTGTGTGTATGAGGGGAGGCAGG - Intronic
1139636440 16:68261080-68261102 CTCTGAGCATGAGGGGAGGGAGG + Intergenic
1139968785 16:70761013-70761035 GTGTGTGCATGGGGGGGCGGGGG + Intronic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140415572 16:74771778-74771800 CTGTGACCATGGGGGGAAGGGGG - Intronic
1140669569 16:77263929-77263951 CTGTGTGGGGGTGGGGAGGAGGG - Intronic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141376849 16:83539176-83539198 CTGTGGGCAAGGGTGGGGGATGG + Intronic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1141625486 16:85259099-85259121 CTCAGTGCAAGGGAGGAGGAGGG + Intergenic
1141946011 16:87310713-87310735 CTGGCTGCATGGAGGGAGGTGGG - Intronic
1141949304 16:87330452-87330474 CCGTGTGCGTGCAGGGAGGAAGG + Exonic
1142062634 16:88040590-88040612 CTGTGGGCATGGGGGTGGGGAGG - Intronic
1142074244 16:88108223-88108245 CTGTGGGGATGCGGGGAGGGGGG + Intronic
1203141176 16_KI270728v1_random:1767805-1767827 CTGTGTTACTGGTGGGAGGAGGG + Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143060426 17:4196033-4196055 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1143563306 17:7707683-7707705 CGGTGTGCATGTGGTGAGGGCGG + Intronic
1143952969 17:10648159-10648181 CTGTGTGGTTGTAGGGAGGAGGG - Intronic
1144130669 17:12243571-12243593 CTGCTTGCATGGAAGGAGGAAGG - Intergenic
1146183516 17:30710959-30710981 ATGTGTGCCTGGGGGCAGGAGGG + Intergenic
1146320421 17:31842394-31842416 GTGTGTGCATATGGGAAGGAAGG - Intergenic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146575237 17:33985282-33985304 ATGTGTGAGTGGGGGGAGGTTGG - Intronic
1146589550 17:34116845-34116867 AAGTGTGTGTGGGGGGAGGAGGG + Intronic
1146663315 17:34679756-34679778 ATGTCTGCATGGCAGGAGGATGG + Intergenic
1146749814 17:35368317-35368339 CTGTGTGCTTGGGGAAGGGAGGG + Intronic
1146798374 17:35798937-35798959 CTGTGTGGATGCTGGGAGGATGG + Intronic
1147056913 17:37841837-37841859 CTCAGTGCATGGGAGGAAGAAGG - Intergenic
1147150684 17:38511816-38511838 CTGTGTGCCTGGGCTGTGGAAGG - Exonic
1147182635 17:38696195-38696217 CTGTGTGCCCTGGTGGAGGAGGG - Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147310192 17:39591452-39591474 TTGGCTGCATGGGTGGAGGAAGG + Intergenic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1147495575 17:40912059-40912081 CAGTGTGGATGGGTGGAAGAGGG + Intergenic
1147554004 17:41464759-41464781 CTGTGTTCATCCTGGGAGGAGGG + Intronic
1147592828 17:41695910-41695932 GTGTGGGGATGGGGGCAGGAGGG - Intergenic
1147608800 17:41789252-41789274 GTGTGTGCATGTGTGGAGGTGGG - Intergenic
1147624835 17:41893255-41893277 CTGTGGACATGGGGCGTGGAGGG - Intronic
1147746886 17:42700235-42700257 CTGTGTGCTTTGGGGCTGGAAGG - Intergenic
1148158936 17:45439148-45439170 GTGTATGCATGGGTTGAGGAGGG - Intronic
1148518124 17:48241344-48241366 CTGTGTGCATGTGTGGAGGTGGG + Intronic
1148683032 17:49485635-49485657 CTGTCTGCCTGTGGGCAGGAAGG + Intergenic
1148756823 17:49977564-49977586 CTGTGTGTATTTGGTGAGGAGGG - Intergenic
1148778936 17:50110954-50110976 CTGTGTGCTTAGGGGAAGGGTGG - Exonic
1149054511 17:52347031-52347053 CTGTGTGCAAGGTGGGTGGGGGG + Intergenic
1149456080 17:56789652-56789674 GTTTGTGGATGGGGGGAGGGCGG + Intergenic
1150005069 17:61464140-61464162 GTGCGTGCCTGGAGGGAGGAGGG - Intronic
1150250538 17:63702008-63702030 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1150390290 17:64786237-64786259 GTGTATGCATGGGTTGAGGAGGG - Intergenic
1150469062 17:65420676-65420698 TTGTTTGCATGGGGAGAGGGAGG + Intergenic
1151834527 17:76574179-76574201 CTGGGTGCTTGGACGGAGGAGGG + Intronic
1151885593 17:76921580-76921602 GGGTGTGCATGGAGGGAGCAGGG - Intronic
1152573510 17:81130570-81130592 CATTGTGCATGGCAGGAGGAGGG - Intronic
1152603599 17:81277842-81277864 CTGTGTGCAGCCGGGGAGAAGGG + Intronic
1152700264 17:81815101-81815123 GTGTGTGCATGGGCTGGGGAAGG + Intergenic
1152716804 17:81904147-81904169 CTGGGTGCATGGTGGGGGCAGGG + Intronic
1153180981 18:2432719-2432741 GTGTGTGCATGTGTGTAGGATGG - Intergenic
1153871368 18:9323417-9323439 CAGTGTGTATTGGGGGAGGAGGG - Intergenic
1153961350 18:10142820-10142842 CTGGCTGCATGGGGGAAGGGAGG - Intergenic
1153980896 18:10309535-10309557 CTGTGTAATTGAGGGGAGGAGGG + Intergenic
1154093028 18:11382250-11382272 CTCTGTGCATGGGGGGAGAGGGG + Intergenic
1154325866 18:13389930-13389952 CTGTGAGCAAGTGGGGAGGAAGG - Intronic
1154342461 18:13515276-13515298 CTGTAGGCATGAGGGAAGGAAGG + Intronic
1156055400 18:32997159-32997181 CTCTGTGTGTGGGGGTAGGATGG + Intronic
1156357406 18:36354092-36354114 CTGTGTGCCTGGGGAGAAAAGGG + Intronic
1156913140 18:42435000-42435022 ATGAGTGCATGGGAGGTGGAAGG + Intergenic
1157513184 18:48293257-48293279 TTGTGTGCATGCAGTGAGGAAGG - Intronic
1158243691 18:55406733-55406755 TTGTGGGGATGGGGGGAGGCGGG - Intronic
1158626903 18:59079420-59079442 CTGGCTGCATGGGGAGAGGCTGG + Intergenic
1158932399 18:62334465-62334487 CTCTGTGTAGGGTGGGAGGAGGG + Intronic
1159003029 18:62989772-62989794 GTGTGTGCATGGGATGAGGGGGG - Intergenic
1159505739 18:69333019-69333041 TTTTGTGTATGGGGTGAGGAAGG + Intergenic
1159554657 18:69932772-69932794 GTGTGTGCATGTGGGAAGGAGGG - Intronic
1159678364 18:71314860-71314882 CAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1159994998 18:74955829-74955851 GTGTGTGCAGGGAGAGAGGATGG - Intronic
1160025875 18:75215796-75215818 GTGTGTGCAGGGTGGTAGGAGGG - Intronic
1160179715 18:76623756-76623778 CTGTGTGCTTGGAGCGAAGAGGG + Intergenic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1160572479 18:79827534-79827556 CTGTGTTCCTGGAGGAAGGAGGG + Intergenic
1160745721 19:709902-709924 CTGTGTGTGTGGGGGGGGGGTGG + Intronic
1160767804 19:816190-816212 TTGGGTGCATGGGTGGAGAATGG - Intronic
1160767858 19:816407-816429 GTGGGTGCATGGGTGGAGAATGG - Intronic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1160767947 19:816777-816799 TTGGGTGCATGGGTGGAGAATGG - Intronic
1160878049 19:1306702-1306724 CTGTATGCATGGGGGAGGGCAGG - Intergenic
1160964593 19:1741215-1741237 CTGTATGCATGGGGGAGGGCAGG - Intergenic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161480553 19:4508210-4508232 CTGTGTGCAGAGGGGGATGTGGG - Intronic
1162975274 19:14204802-14204824 ATGTGTGCCTGGGGGCAGGAGGG - Intronic
1163072230 19:14853832-14853854 GTGTGTGCAAGGTGGAAGGAAGG + Intergenic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1164711344 19:30359270-30359292 CAGTGTGCATGGTGTGGGGAGGG + Intronic
1164906935 19:31975406-31975428 ATGAGTGCATGAGGGCAGGAGGG + Intergenic
1165069348 19:33246888-33246910 ATATGTGTATGGGAGGAGGAAGG + Intergenic
1166125976 19:40715638-40715660 CAGTGTGCAAGTGGGGGGGAGGG - Intronic
1166366422 19:42280673-42280695 CTTTGTGCAGGGAGGGCGGACGG - Intronic
1166432877 19:42741609-42741631 CTGTGTGCTTGCTGGGAGAAGGG - Intronic
1166445867 19:42856863-42856885 CTGTGTGCTTGCTGGGAGAAGGG - Intronic
1166448846 19:42880824-42880846 CTGTGTGCTTGCGGGAAGAAGGG - Intronic
1166453247 19:42919014-42919036 CTGTGTGCTTGCGGGGAGAAGGG - Intronic
1166465529 19:43027598-43027620 CCGTGTGCTTGCGGGGAGAAGGG - Intronic
1166485285 19:43206752-43206774 CTGTGTGCTTGTGGGGAGAAGGG - Intronic
1166829465 19:45630095-45630117 TGGTGGGCATGGGGGGAGGATGG - Intronic
1166995089 19:46716361-46716383 CGGTGGCCATGGGGGGAGGCCGG + Exonic
1167560408 19:50223483-50223505 CTGTGTGCCTGGGGTGGGGCTGG + Intronic
1167695942 19:51015721-51015743 CTGTGAGTCTGAGGGGAGGAGGG - Intronic
1167820998 19:51927559-51927581 CTGTCAGGATGAGGGGAGGAGGG + Intronic
1168060398 19:53888925-53888947 CTGTGTGCAGGGGGAGTGGCAGG - Intronic
1168266811 19:55227870-55227892 CTGTATGCCTGTGTGGAGGAAGG - Intronic
925066270 2:931119-931141 CTCTGTGGATGGGTGGATGAAGG - Intergenic
925154495 2:1639200-1639222 CTGTGGGCCTGTGGCGAGGATGG - Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925840153 2:7984421-7984443 ATGTGTGCATGAGGGACGGAAGG - Intergenic
926587149 2:14699366-14699388 CTGAGTGCATGGAGGAAGGAGGG - Intergenic
926756991 2:16244359-16244381 CCGTGGGCCTGGTGGGAGGAGGG + Intergenic
927081285 2:19633351-19633373 CTGCGTCCATGGGGGGAGCTTGG - Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927641859 2:24850389-24850411 TTGTGTTCCTGGGGGAAGGAAGG + Intronic
928196035 2:29217378-29217400 CTGTGTGCATGGGTGGGGTGGGG + Intronic
928239764 2:29576380-29576402 CAGTGTGCATGGTGGTAGGAAGG - Intronic
928981612 2:37141562-37141584 CAGTGTGCATCGGGGGTGCATGG - Exonic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929168899 2:38911490-38911512 ATGTGTGTATATGGGGAGGAGGG + Intronic
931748049 2:65307946-65307968 CTGTGTGAATGGGGGGGGCGGGG - Intergenic
932097012 2:68859814-68859836 CTGTGTGAATGGTCTGAGGAAGG + Intergenic
932425494 2:71631833-71631855 CAGTGTGCAGCGAGGGAGGAGGG - Intronic
932757382 2:74417885-74417907 GTGGGTGGACGGGGGGAGGAGGG + Intronic
932969978 2:76528794-76528816 CTGTGTGTATGGGTGGATGCAGG - Intergenic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
934108711 2:88721572-88721594 ATGTGTGCATGTGGGGGGGGGGG - Intronic
934559159 2:95303405-95303427 CTGTGTTCAGGGGGAGAGGAAGG + Intronic
935438798 2:103067562-103067584 ATGTGTACATTGGAGGAGGATGG - Intergenic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
936063451 2:109313147-109313169 CTGTGTGCATGGGCTGAGCTGGG + Intronic
936239834 2:110777786-110777808 CTGTGTGTATGTGGGGTTGAGGG + Intronic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
936522648 2:113220714-113220736 TTGTGTGCATGGGGGGCTGAGGG + Intronic
937246138 2:120495198-120495220 GTGTGTGTGTGGGGGGGGGAGGG - Intergenic
937727623 2:125186305-125186327 CAGTTTGCATGGGGAGAGGGAGG + Intergenic
938141693 2:128799645-128799667 CTGTGTGCATGGGCAGAGCCTGG + Intergenic
938392732 2:130917636-130917658 CTGTGTTCACTGGGGGAGGGGGG - Intronic
938727772 2:134121991-134122013 CAGTGAGGACGGGGGGAGGAGGG - Intronic
941112730 2:161434211-161434233 GTGTGTGCATGGTGGGAGGCAGG - Intronic
941870948 2:170385104-170385126 CAGGGTGTATGGGGGGAGGAAGG + Intronic
941945531 2:171092639-171092661 TTTTGTCCATGGGGGTAGGAGGG - Intronic
942046996 2:172105438-172105460 TTGTGTACATGGGGGAAAGAGGG + Intergenic
942371869 2:175294144-175294166 CTGTGTGCCTGGAGGGGGCATGG - Intergenic
942561670 2:177226531-177226553 GTGTGTGCATGTGTGGAGGTGGG - Intergenic
943666670 2:190616172-190616194 ATGTGTGGATGGAGTGAGGAGGG + Intergenic
945760548 2:213908918-213908940 TTGTGTGGTGGGGGGGAGGAGGG - Intronic
945986212 2:216355895-216355917 ATGTGTGCTTGTGGGTAGGAGGG - Intronic
946149606 2:217755358-217755380 CTGTTTACATGGGGGGAGTTGGG + Intronic
946196572 2:218035770-218035792 CTGCGTGTGTGGGGGGAGCAGGG - Intronic
946303972 2:218845333-218845355 TAGAGTGCATGGGGGGATGATGG + Intergenic
946450189 2:219773063-219773085 ATGTGTGCATAAGGGGAGGTGGG + Intergenic
946737832 2:222772576-222772598 CTGTCTGCTTGTGGGGAGCAAGG - Intergenic
946768290 2:223060618-223060640 CTCTCTGCACTGGGGGAGGAGGG - Intronic
946818440 2:223605268-223605290 GAGTGTGGATGGTGGGAGGAGGG - Intergenic
947352566 2:229261659-229261681 CTGTGTCCATGGGAGCAGGAGGG - Intronic
948002321 2:234578346-234578368 GTGTGTGTTTTGGGGGAGGAGGG - Intergenic
948134272 2:235624617-235624639 GTTTGTGCTTGTGGGGAGGATGG + Intronic
948267376 2:236644887-236644909 CTGTGGTCATGGGGGCAAGATGG - Intergenic
948374513 2:237512613-237512635 CCGTGTGCGTGTGGGGAGGTGGG - Intronic
948389403 2:237601261-237601283 CTCTGTGCAGGGTGAGAGGATGG - Intronic
948572425 2:238926082-238926104 CTGTGTACCTGGGAGGAGCATGG - Intergenic
948584340 2:239009602-239009624 CTCTGTCCTTGAGGGGAGGAGGG - Intergenic
948673324 2:239582591-239582613 CTGCTTGAATGGGGGGCGGAGGG - Intronic
948711212 2:239826912-239826934 CTGAGTGCACGGAGAGAGGAAGG - Intergenic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
948779497 2:240310165-240310187 CTCTGTGCTTGGGGACAGGAGGG - Intergenic
948791889 2:240383503-240383525 CTGTGTGGATGGGGAGTGGCAGG - Intergenic
948865857 2:240774401-240774423 CTGTGTTCATGGGGTGGGGGTGG - Intronic
948896393 2:240929901-240929923 CTGCGTGCATGGAGGTGGGAGGG - Intronic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1169927594 20:10799135-10799157 CTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1170391959 20:15884898-15884920 CTGTGTCCATGCATGGAGGAAGG + Intronic
1172501794 20:35432936-35432958 CTGTGAGTATGGGGGTAGCAGGG + Intergenic
1172803027 20:37591578-37591600 CTGTGTGGGTTTGGGGAGGAAGG - Intergenic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1173653774 20:44684771-44684793 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1173697935 20:45037300-45037322 ATGTGTGCAAAAGGGGAGGAAGG + Intronic
1173705538 20:45107754-45107776 CTGTAAGCATGGGGTGGGGAGGG + Intergenic
1174190740 20:48738671-48738693 CTGTGGGTTTGGGGGGAGAAGGG + Intronic
1174283073 20:49453294-49453316 CAGTCTGCCTGGTGGGAGGACGG + Intronic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175548859 20:59802606-59802628 CTGTGTGCAGGGAGCGTGGAAGG + Intronic
1175815023 20:61878779-61878801 CTGTGTGCAAGGCGGGAGACAGG - Intronic
1175825925 20:61936481-61936503 CTGTGGGCAGGGGAGGCGGAGGG - Intronic
1175962067 20:62642354-62642376 CTGTGCCCTGGGGGGGAGGAGGG + Exonic
1176522479 21:7834909-7834931 ATGTGTGCATTGGGGTAGGTGGG - Intergenic
1176940288 21:14915638-14915660 GTGTGTGGATGGGGGTGGGAGGG + Intergenic
1177038101 21:16070590-16070612 CTTTTTGCAAGGGGGGTGGAGGG + Intergenic
1177166769 21:17612637-17612659 CTGTGGGTATCGGGGGAGGGTGG - Intronic
1178493266 21:33067719-33067741 CTGTGTGCAGGGGAGGAAGCCGG + Intergenic
1178599767 21:33985579-33985601 GTGTGTACATGGTGTGAGGAGGG - Intergenic
1178656499 21:34464921-34464943 ATGTGTGCATTGGGGTAGGTGGG - Intergenic
1179182402 21:39057139-39057161 CTAAGGGCATGGGGGCAGGAGGG - Intergenic
1179565630 21:42246101-42246123 CAGTGTGGATGGGTGGAGAAGGG - Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179652380 21:42820020-42820042 CTGTGTGCTTGTGGGAGGGAAGG + Intergenic
1180060045 21:45380199-45380221 CTGTGTGCATGGATGGACGCTGG - Intergenic
1180090037 21:45529221-45529243 CTGCCTGCATGTGGGGAGGATGG + Intronic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180960957 22:19762150-19762172 CTGTGTGCCTGGGGACAGCAAGG - Intronic
1180971059 22:19815974-19815996 CTGTGTGCACAGGGCTAGGAGGG - Intronic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1182573771 22:31259098-31259120 CTGTGAGCAGGTGGGGAGAAGGG - Intronic
1182700155 22:32230227-32230249 CTGTGTGTCAGGGTGGAGGAAGG + Intronic
1182939551 22:34262256-34262278 CTGTGGGCATAGGGAGTGGAGGG + Intergenic
1183744447 22:39684973-39684995 CTGTGTGCCCGTGGGTAGGAGGG - Intronic
1183933337 22:41248463-41248485 CTTGGTGCATGTGGGGAGGCGGG - Intronic
1184098460 22:42329255-42329277 CTGTGTGCTGGGGATGAGGATGG - Intronic
1184281330 22:43439202-43439224 CTGCGTTCATGGGAGGGGGACGG + Intronic
1184458333 22:44623944-44623966 CTGTGTGCTGGGGGGAGGGATGG + Intergenic
1184602550 22:45552178-45552200 GTGTGTGCTAGGAGGGAGGAGGG + Intronic
1184835652 22:47019557-47019579 GGGTGTGCAGGGAGGGAGGATGG + Intronic
1184866488 22:47204483-47204505 CTGTGTGCCTGTGGGGAGGAGGG - Intergenic
1185193399 22:49452920-49452942 ATGTGTGGATGGGTGGTGGATGG + Intronic
1185193489 22:49453397-49453419 ATGTGTGGATGGGTGGTGGATGG + Intronic
1185288680 22:50013599-50013621 GTGTGTGTGTGGGGGGGGGATGG + Intergenic
949408525 3:3739699-3739721 GTGTGTGTGTTGGGGGAGGAAGG - Intronic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950355630 3:12406097-12406119 CTGTCTTCATTGGGGGAGGCGGG + Intronic
950675853 3:14554030-14554052 GTGTGTGCATGGGGAGAGGAAGG + Intergenic
950726899 3:14922572-14922594 GTGTGTGCATGGGGGTGGGGTGG + Intronic
951258503 3:20479689-20479711 GTGTGTGCAAGGGGGGGGCAGGG - Intergenic
951614208 3:24523162-24523184 CTTTGTGTGTGGGGGGGGGAGGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952455099 3:33465460-33465482 CAGTTTGCATGGGGAGAGGGAGG + Intergenic
952978343 3:38715144-38715166 CTGGGTGCATGAGGGTAGGGAGG + Intronic
954801702 3:53190736-53190758 CTGTGTGCCCTGGTGGAGGAGGG - Intronic
954876245 3:53804875-53804897 CTGTGTCCAAGGGAGGAGGCGGG + Intronic
954917970 3:54164685-54164707 CAGTGGGGATGGGGGAAGGATGG + Intronic
955588685 3:60510709-60510731 TTGTGTGTGTGGGGGGAGGTGGG - Intronic
956028972 3:65015775-65015797 ATGGGTGCATGGGTGAAGGAAGG + Intergenic
956284028 3:67589715-67589737 CTGTGTGCAGGAGAGGTGGATGG + Intronic
956391118 3:68773517-68773539 GTGTCTGCATGGGTAGAGGAGGG - Intronic
956916542 3:73877895-73877917 GAGTGTGCATGTGGGAAGGAAGG + Intergenic
957079383 3:75623543-75623565 CTGTGTGCACTGGGGGGGGGGGG - Intergenic
959894641 3:111592506-111592528 CTGTCTGAATGAGGGAAGGATGG - Intronic
960021333 3:112957084-112957106 CTGTGTACTTGGGGGAAAGAGGG - Intronic
960294685 3:115928671-115928693 CAGAGTGCAGGGGGTGAGGAGGG + Intronic
960704022 3:120464750-120464772 CTGGGAGAATGTGGGGAGGATGG + Intergenic
960900884 3:122553336-122553358 ATCTGGGCATGGGGGAAGGAAGG - Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961829520 3:129616280-129616302 GTGTGTGCATGTGGGCATGAGGG + Intergenic
962323160 3:134407683-134407705 ATGTGTGGGTGAGGGGAGGAAGG - Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
963320682 3:143806097-143806119 CTGTGTGTGTGGGTGGGGGACGG - Intronic
963431854 3:145216804-145216826 CTGTGTGTGTGGGGGTGGGAGGG + Intergenic
963525629 3:146411042-146411064 CTGTGTGAATGGTGTGTGGATGG - Intronic
964784438 3:160379551-160379573 GTGTGTGCTGGGGGCGAGGAGGG + Intronic
965372384 3:167879679-167879701 TTGTGTGCATGAGGGGAGAGAGG - Intergenic
965908274 3:173738414-173738436 TTTTGTGCATGGTGTGAGGAAGG + Intronic
967982391 3:195073478-195073500 TTGTGGGCATGAGGGGGGGAGGG - Intronic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968132147 3:196198140-196198162 CTCCGAGCTTGGGGGGAGGAGGG - Intronic
968649336 4:1754200-1754222 CTGGGGGCATGTGGGGAGGAGGG + Intergenic
969369222 4:6720625-6720647 ATATTTGCATGGGGGTAGGAGGG + Intergenic
969832169 4:9806664-9806686 CTGTGTGCATGGGGGGTGGGAGG + Intronic
969898634 4:10328133-10328155 CTGTGACCATGAGGGGTGGAAGG - Intergenic
970143053 4:13003509-13003531 GTGTGTGTGTGGGGGGAGGGGGG + Intergenic
971219402 4:24691358-24691380 GTGTGTGCATGGGGAAAGTAGGG + Intergenic
972184948 4:36517452-36517474 TTTTGTGCATTAGGGGAGGAAGG + Intergenic
972861959 4:43180208-43180230 CATTGTGCATGAGGGCAGGAAGG - Intergenic
973570477 4:52233937-52233959 TTGTGTGTGTGGGGGGGGGAGGG + Intergenic
975459063 4:74629324-74629346 CTGTGTGCATGAAGGAATGAAGG - Intergenic
976082942 4:81376048-81376070 CTGTGTGCTTGAGGCGGGGAGGG - Intergenic
976470570 4:85423982-85424004 GTGTGTGGAAGGGGGGCGGAGGG + Intergenic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977660907 4:99584862-99584884 CTGGGTGCTTTGGGGAAGGAGGG - Intronic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
979669102 4:123343574-123343596 CTGTGTGCTTGGAAGGAGGTGGG - Intergenic
979835318 4:125359798-125359820 CTGTGTGTTTGTGGGGAGGGAGG + Intronic
982899650 4:160981838-160981860 CTGTGGGCATTGGGGGTGGAGGG + Intergenic
983074784 4:163312739-163312761 CTGTGTGTATGGGGGTGGCAAGG - Intergenic
983774415 4:171588329-171588351 CTGTGTTCATTGGGAGAGAAAGG - Intergenic
983938552 4:173519486-173519508 CTGTGTGCGTGGGGAGGGGGCGG - Intergenic
984649578 4:182255716-182255738 TTATGTGTATGGGGAGAGGATGG + Intronic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985516103 5:345488-345510 ATGTGTGTATGTGGGGGGGAGGG + Intronic
986315901 5:6586173-6586195 CTGAGTGCCAGGGAGGAGGAGGG - Intergenic
986363260 5:7002674-7002696 CTATGTGCTTGTGGGGAGAAGGG + Intergenic
986441574 5:7787189-7787211 CTGTGTGCAGGGGAGGAACAGGG - Intronic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986589824 5:9357033-9357055 CTGTGTGAATGGGCTCAGGAAGG - Intronic
986638185 5:9845208-9845230 CTTGGTGCATGTGGGGTGGAGGG - Intergenic
986841926 5:11707331-11707353 CTGTGTGCATGAGAGGAGGATGG - Intronic
992090404 5:73311592-73311614 CTGGGTCCATGGGCGGAGGGCGG - Intergenic
992166362 5:74055925-74055947 CTGGGGGCATGGGGGAAGGAGGG - Intergenic
992657110 5:78921894-78921916 CTGTGTTCTTGGGGGAAGGAAGG + Intronic
993167066 5:84370383-84370405 GTGACTGCATGGTGGGAGGAGGG + Intronic
993256981 5:85604456-85604478 CTGTGTCCTTGGGGGAGGGAGGG + Intergenic
993536038 5:89087674-89087696 CTGTGTTGATGGGGTGGGGAAGG - Intergenic
994305517 5:98199261-98199283 ATGTGTGCATGGGGGCAGGGTGG + Intergenic
995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG + Intronic
995866199 5:116693831-116693853 CATTGTGCATGGGGGGAGGAGGG + Intergenic
996103489 5:119470292-119470314 GTGTGGGCATGGTGGGATGATGG + Intronic
996198889 5:120645380-120645402 GTGTGTGTGTGGGGGGGGGATGG - Intronic
997400486 5:133598219-133598241 GTGTGTGCATGCGAGGAGGCAGG + Intronic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
998785650 5:145705909-145705931 ATGTGTGCATGGGTGGTGTATGG - Intronic
999208889 5:149870579-149870601 CTGTGTGCATGGGATGAAGGAGG + Intronic
999651659 5:153774067-153774089 GTGTGTGTGTGGGGGGAGGGGGG - Intronic
999849598 5:155523915-155523937 CTGTGTGCTTGGGAGGGGGATGG - Intergenic
1000653575 5:163848521-163848543 GTGTGTGCCTTGGGGGAGCAAGG - Intergenic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1001017501 5:168154614-168154636 CTGTCTGCATGGGACAAGGAAGG - Intronic
1001332602 5:170772780-170772802 GTGTGTGCATGTGGAGGGGAAGG + Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002570409 5:180136628-180136650 CTCTGTGCCAGGGAGGAGGAGGG + Intronic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1004825552 6:19416787-19416809 CTCTGTGTATGGTGTGAGGAAGG + Intergenic
1005430407 6:25750776-25750798 TTGTGTGTGTGGGGGGAGGGGGG + Intergenic
1006004094 6:30988776-30988798 CTGTGTGTGGGGGGGGAGGGGGG + Exonic
1006808867 6:36806947-36806969 CTATGTGGATGGGGCCAGGATGG - Intronic
1006917310 6:37602931-37602953 CAGTGAGCATGTGGGAAGGAGGG - Intergenic
1007231017 6:40347857-40347879 CTGTGGGGAGGAGGGGAGGAGGG - Intergenic
1007235984 6:40391896-40391918 CTGTGCGCAGGGTGGGAGAAGGG - Exonic
1007264658 6:40587422-40587444 CAGTGTGCATGCGGGGAGTACGG - Exonic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007761324 6:44135223-44135245 ATGTGGGCATGGGGGCATGAGGG + Intronic
1007790575 6:44306082-44306104 CTGTGGACATGGGGAGAGGCAGG + Intronic
1008683222 6:53896419-53896441 GTGTGTGTATGGGGGAAGGGAGG + Intronic
1008875240 6:56318909-56318931 GTGTGTGTTTGGGGGGAGGTGGG - Intronic
1010872373 6:81058944-81058966 CCGTTTGCACGGGGAGAGGAAGG + Intergenic
1011130089 6:84043641-84043663 GTGTGTGTATGGGGGGGTGAGGG + Intronic
1011290510 6:85772229-85772251 GTGTTTGCATGGAGGCAGGACGG + Intergenic
1011591167 6:88972087-88972109 CAGTTTGCATGGGGAGAGGGAGG - Intergenic
1013135281 6:107276408-107276430 GTGTGTGGTTGGGGGGAGGGTGG + Intronic
1014002879 6:116384485-116384507 CTTTGTGCCTTGGGGGAGGCTGG + Intronic
1014406031 6:121052347-121052369 CTGTGTTCATGGAGGGAGACAGG - Intergenic
1014692328 6:124577385-124577407 CTGTGTGCTTGGGGGACAGAAGG + Intronic
1015557862 6:134481769-134481791 CTTTTTGAGTGGGGGGAGGAAGG + Intergenic
1016472333 6:144387894-144387916 CTGTCTGCTTTGGTGGAGGATGG - Intronic
1017549760 6:155493397-155493419 GGGTGTGGATGGGGGGAGGAGGG + Intergenic
1018579673 6:165297762-165297784 GTGTGTCCATGGGGGGAGTTTGG - Intronic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1020106788 7:5425909-5425931 CTGTGTGCCTTAGGGGAGGAGGG + Intergenic
1020144792 7:5634195-5634217 CTGTGACCATGGGGGAAGAACGG + Intronic
1021912678 7:25401878-25401900 CTGTGTGCATGGTGGGGGAAGGG - Intergenic
1022514927 7:30969438-30969460 CTGGCTGCAAGGGTGGAGGAGGG + Intronic
1023158500 7:37275275-37275297 CTGGGTGCTGGGTGGGAGGAGGG + Intronic
1023393608 7:39732892-39732914 CAGTGTGCATGGCGGGAAGGAGG - Intergenic
1023742649 7:43294357-43294379 CTGTTCCCATGGGGGGAGGGGGG + Intronic
1023984429 7:45086691-45086713 CTGGGTGCAGGAGGGGAGCAGGG - Intronic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024655389 7:51447595-51447617 CAGTTTGCATGGGGAGAGGGAGG - Intergenic
1024754685 7:52516024-52516046 CTGTGTGCATGGGAGGAATTTGG - Intergenic
1025022037 7:55487877-55487899 CTGTAGGCCTGGGGGAAGGAAGG - Intronic
1026422842 7:70258290-70258312 CTGTGTTCATAGGGGAAAGATGG + Intronic
1026883098 7:73919885-73919907 CAGTGGGGAGGGGGGGAGGAGGG - Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1026979806 7:74519626-74519648 CTGGGGGCAAGGGGGCAGGAAGG - Exonic
1027522675 7:79229939-79229961 CTGTGAGGGTGGGGGGAGGGGGG - Intronic
1027917446 7:84343666-84343688 CAGTATGGATGGGGAGAGGAGGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1029440469 7:100584361-100584383 CTGTGAGCTTGGGGGGGGGTCGG - Intronic
1030064433 7:105648600-105648622 CTGTGTGTATGGGAGGTGGGGGG - Intronic
1030864272 7:114679630-114679652 GAGAGTGCATGGGGGAAGGAGGG - Intronic
1031409965 7:121429884-121429906 TTGTGTGTGTGGGGGGGGGAGGG - Intergenic
1031976247 7:128095410-128095432 CTGTGAGCAGGTGGGGAAGAAGG + Intergenic
1032284910 7:130532551-130532573 TTGTGTGGATGTGAGGAGGAGGG + Intronic
1032582556 7:133116867-133116889 CTGTGTGTGTGTGGGGAGGGGGG - Intergenic
1032632559 7:133669419-133669441 CTGTGTGGGTGTGGGGAGGACGG + Intronic
1033391862 7:140936470-140936492 CTGTGTGGATATGGGGAGAAAGG - Intergenic
1034400783 7:150860285-150860307 CTCTGTGCATTTGGGGAGGGGGG + Intronic
1035093040 7:156330485-156330507 CAGTGTGCATGGGAGAAGCATGG - Intergenic
1035248569 7:157581379-157581401 CTGTGGGCCTGGGGTGGGGAGGG + Intronic
1035284766 7:157799169-157799191 CTGTGTGCTCGTGGGGAGGAAGG + Intronic
1035288194 7:157819550-157819572 GTGTGTGCTTGGGGCGGGGAGGG - Intronic
1035308777 7:157952019-157952041 CTGTGAGCTTGGGAGGAAGATGG - Intronic
1035466115 7:159079032-159079054 CAGTGTCCATGGAGGAAGGATGG + Intronic
1035576426 8:709824-709846 CTGTATGCATGGATGGATGATGG - Intronic
1035624493 8:1060804-1060826 CTGTGGGCCTGGGAGGAGGCAGG + Intergenic
1035675791 8:1454875-1454897 CTGTCTGCATGACGGGAGGGTGG - Intergenic
1035869700 8:3124132-3124154 CTGTGTGCGTGTGGGGAGGGGGG + Intronic
1036401627 8:8413837-8413859 CTGGGTGCCTGGGGGGAGGAGGG + Intergenic
1036644352 8:10602441-10602463 CTGTGGACACGGGGGCAGGAGGG + Intergenic
1036760244 8:11503720-11503742 CTATGTGCAGGTGTGGAGGATGG + Intronic
1036786106 8:11688623-11688645 GTGTGTGCATGGGGACAGGAGGG + Intronic
1037010941 8:13841648-13841670 AAGTGTGCATGGGGGGATGCTGG + Intergenic
1037062538 8:14532702-14532724 CTTTGTGTGTGGGGGGAGGGCGG + Intronic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037796273 8:21997836-21997858 CAGTGTGGTGGGGGGGAGGAAGG + Intronic
1037802627 8:22043756-22043778 AGGTGTGCATGGAGGGAGGTGGG - Intronic
1038692264 8:29774177-29774199 CTGTGGGCATTGGGGGAGGGAGG - Intergenic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1040447519 8:47510939-47510961 GTGTGTACAAGGGGGCAGGAGGG + Intronic
1040604516 8:48918150-48918172 GTATGTGCCTTGGGGGAGGAGGG - Exonic
1040694646 8:49980986-49981008 CTGTGTGCATGGGGCTCAGAAGG - Intronic
1040912533 8:52534744-52534766 GTGTGTGCAGAGGGGCAGGAAGG + Intronic
1040913585 8:52545500-52545522 GTGTGTGCAGGGAGGGAGGTGGG - Intronic
1040975692 8:53191921-53191943 ATGTGTGCATGAGGGGGAGATGG - Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041272076 8:56118646-56118668 CTGTTTCCATGCGGGGAGGTTGG + Intergenic
1042070175 8:64924287-64924309 CTGTGTAGTTGGGGGAAGGAGGG + Intergenic
1042373481 8:68019423-68019445 CTGTCGGCAAGGTGGGAGGAAGG + Intronic
1043362410 8:79490271-79490293 CTGTGGGCAGTGGGGGAGAAAGG + Intergenic
1043567200 8:81561624-81561646 CTGTGTGCATGGGGGAAGGAGGG + Intergenic
1044305820 8:90639373-90639395 CTGTGTGTATGTGGGTGGGAGGG - Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1045108339 8:98915771-98915793 GTGTGTGGAGGGGCGGAGGATGG - Intronic
1046530772 8:115442595-115442617 GTGTGTGTTTGGGGGAAGGAAGG + Intronic
1047179370 8:122572528-122572550 GTGTGTGCATGGGGGCAGGAAGG + Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048257333 8:132915114-132915136 GTGTGTGCATGTTGGGAGCAGGG + Intronic
1048345863 8:133573694-133573716 TTGTGTGCATGGGAGGAGGGGGG + Intergenic
1048351159 8:133617842-133617864 GTGTGTGTATGGGGCGGGGAGGG + Intergenic
1048389506 8:133948152-133948174 CTGTGTGTATGGGGTGGGGGTGG + Intergenic
1048560862 8:135536010-135536032 GTGAGTGCCTGGGGGTAGGAGGG + Intronic
1048916826 8:139192609-139192631 CTGGGAGCATGGGGTAAGGAGGG + Intergenic
1049159597 8:141088900-141088922 CTGGGTACATGTGGGGTGGATGG + Intergenic
1049167073 8:141133120-141133142 CAGTGAGCGTGGGGGGTGGAGGG + Intronic
1049171755 8:141165878-141165900 CTTTGAGGATGGGGGGAGGTGGG - Intronic
1049204117 8:141355447-141355469 CTGTGTGGCTGGGAGCAGGAGGG - Intergenic
1049204213 8:141355844-141355866 CTGTTTGCATGGGGAGATGGTGG + Intergenic
1049865589 8:144933607-144933629 CTGTGGGCAGGAGGGGAGGTTGG - Intronic
1050009590 9:1172164-1172186 CTGGGTGGATGGGGAGAGGAAGG + Intergenic
1050143254 9:2538637-2538659 CTGTGGGGAGGTGGGGAGGAGGG - Intergenic
1050350254 9:4734384-4734406 GTGTGGGCATGGGAGCAGGAGGG - Intronic
1050785428 9:9395116-9395138 CTCTATGGATGAGGGGAGGAAGG - Intronic
1051605887 9:18917534-18917556 CTGTGTGCTTTGAGGGAGAAGGG - Intergenic
1052067033 9:24034660-24034682 CTATGTCCAGGGAGGGAGGAAGG + Intergenic
1052423692 9:28276238-28276260 CTGTGTACATGAAGAGAGGATGG - Intronic
1052597012 9:30574537-30574559 CTGGGAGCATGGTGGGAGCATGG - Intergenic
1052964802 9:34331840-34331862 TTGAGTGCCTGGGTGGAGGAGGG - Intronic
1053161978 9:35819469-35819491 CTGCGTGCATAGGGGGTGGTGGG - Intronic
1053163422 9:35829065-35829087 CTCTGTGCTTGGGGTGAGAAAGG + Intronic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056304372 9:85274658-85274680 ATGTGTGCGTGCTGGGAGGAGGG + Intergenic
1056383235 9:86074572-86074594 CAGTGTGCAGGGGTGGAGGCTGG + Intronic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1057008734 9:91583347-91583369 ATGGGTGGATGGGTGGAGGATGG + Intronic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1058099734 9:100905686-100905708 CTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1058621160 9:106884559-106884581 CTGCCTCCATGGTGGGAGGAAGG - Intronic
1058838328 9:108879811-108879833 CTGGGTGAATGGGGGTAGGTGGG + Intronic
1058973020 9:110100498-110100520 TTGTGTACATGGGGTGAGGTAGG + Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1059541498 9:115134872-115134894 CCCTGAGCATGGAGGGAGGAAGG - Intergenic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1060439575 9:123626345-123626367 CTGTGTGTCTGGGGGGAGAGGGG + Intronic
1060589434 9:124807766-124807788 CTCTCTGCCTGTGGGGAGGAGGG - Exonic
1060885697 9:127150495-127150517 CTGTGTGGGTGGGGTGAGGGGGG - Intronic
1061284281 9:129613367-129613389 CTGTAGGCAAGGGGGGTGGAGGG + Intronic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1062002517 9:134223867-134223889 CTGTGTGCATGGTCGGGGGTGGG - Intergenic
1062017275 9:134297149-134297171 CTGTGTGCCTGGAGCCAGGACGG + Intergenic
1062062707 9:134505157-134505179 CTGTGTGGATGGGTGGATGCGGG + Intergenic
1062062751 9:134505278-134505300 CTGTGTGGATGGGGGGGTGTGGG + Intergenic
1062107016 9:134761188-134761210 CTGTGTGCATGTGGGGGGATGGG - Intronic
1062119493 9:134826665-134826687 GTGTGTGTATGGGTGGTGGATGG + Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062222446 9:135424557-135424579 ATGTGTGCAGGGGGGGCGGAGGG + Intergenic
1062296859 9:135835232-135835254 CTGTGTGTGTGGGGGCGGGAGGG - Intronic
1062433351 9:136535552-136535574 ATGGGTGCATGGTGGGTGGAGGG + Intronic
1062745275 9:138208018-138208040 CTGAGTGCATGGGTCCAGGAAGG + Intergenic
1185701486 X:2234159-2234181 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1185701497 X:2234235-2234257 CTGTGTGCATGGATGCAGGCAGG - Intronic
1185701508 X:2234311-2234333 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1185701518 X:2234369-2234391 CTGTGTGCATGGATGAAGGCAGG - Intronic
1185719667 X:2371693-2371715 CTGTGATAATGGGAGGAGGAGGG - Intronic
1185719674 X:2371717-2371739 CTGTGATAATGGGAGGAGGAGGG - Intronic
1186367263 X:8908853-8908875 ATGTGTGCATGGTGGGTGCAGGG + Intergenic
1188593808 X:31872085-31872107 CTGTGTTCAAGGTGGGGGGAGGG - Intronic
1189006456 X:36999931-36999953 CAGTTTGCATGGGGACAGGAAGG - Intergenic
1189921943 X:45910861-45910883 CTGTGTGTGTGGGGAGGGGAGGG + Intergenic
1190914350 X:54799270-54799292 CTGTGTGGATGGGTAGAGGCCGG - Intergenic
1191734347 X:64373646-64373668 GTGTGTGGTTGGGGAGAGGAAGG + Intronic
1192002738 X:67172907-67172929 ATGTATACATGGGGGGAGGGGGG - Intergenic
1192037956 X:67586254-67586276 TTGTGTGTTTGGGGGAAGGAGGG - Intronic
1192260195 X:69501488-69501510 GTGTGTGCTTGGGGAGAGGGAGG + Intergenic
1192639744 X:72850445-72850467 GTGTGTGTATGGGGGGAGGGGGG - Intergenic
1192641967 X:72870360-72870382 GTGTGTGTATGGGGGGAGGGGGG + Intergenic
1194110270 X:89824827-89824849 CTGTGGGCATGTGGGGATGGAGG + Intergenic
1194598698 X:95892565-95892587 ATGTGTGTGTTGGGGGAGGAAGG + Intergenic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1194976890 X:100405559-100405581 GTGTGTGTATGGGGGGGGGAGGG - Intronic
1195272226 X:103243103-103243125 CTGTGTGTATGGTGGGAGTGTGG - Intergenic
1195606078 X:106807199-106807221 GTGTGTGTATGGGGGGGGGCGGG - Intronic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1195657720 X:107348278-107348300 CTGTGTTCTTGGGGGTGGGAAGG - Intergenic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1195997646 X:110747048-110747070 GTGTTATCATGGGGGGAGGAAGG - Intronic
1196107737 X:111914458-111914480 CTGCGTGCAAGGTGGGAGGGAGG - Intronic
1196401636 X:115323234-115323256 TAGTGTGCAGGGTGGGAGGAGGG + Intergenic
1196405699 X:115360331-115360353 CTGAGTGCATGGGTAGAGGTGGG - Intergenic
1196421686 X:115528722-115528744 CTGTGTGCAGGGGTGGGGGCGGG + Intergenic
1196644605 X:118103728-118103750 CTGTGTGTGTTGGGGGAGGCAGG - Intronic
1196761572 X:119205449-119205471 GTGTGTGGGTGAGGGGAGGAGGG + Intergenic
1197335086 X:125203366-125203388 CTGGGTGCTTGGGGTGAGGATGG - Intergenic
1197487853 X:127075476-127075498 CTGTGTGCTTGGGGGAGGGAGGG - Intergenic
1197762238 X:130036119-130036141 CTGGGTGAATGAGGTGAGGAGGG - Intronic
1198427695 X:136536233-136536255 CGGTGAGCATGTGGGGAGGGAGG + Exonic
1199664210 X:150083679-150083701 GAGAGAGCATGGGGGGAGGAAGG - Intergenic
1199683082 X:150240843-150240865 CTGTGCACATGGTGGGAGGGAGG + Intergenic
1199872940 X:151914007-151914029 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1199873467 X:151916051-151916073 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1199874173 X:151918770-151918792 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1199892016 X:152094432-152094454 CTGTGTGCCTGGGGGTGGGTGGG + Intergenic
1199999166 X:153048409-153048431 ATGTGTGCATGTGGGCAGGGTGG - Intergenic
1200064755 X:153498963-153498985 CTGTGTGCATTGGGAGAGGGTGG + Intronic
1200098049 X:153673395-153673417 ATGTGTGGATGGGGGAGGGACGG - Intronic
1200462931 Y:3479568-3479590 CTGTGGGCATGTGGGGATGGAGG + Intergenic