ID: 1092059106

View in Genome Browser
Species Human (GRCh38)
Location 12:5534179-5534201
Sequence CACATTATGATTTGTGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092059106 Original CRISPR CACATTATGATTTGTGGCAC TGG (reversed) Intronic
912711751 1:111954878-111954900 TACAATATGATTTGTGACATAGG + Intronic
913247734 1:116885004-116885026 CATATTGTGCTATGTGGCACAGG - Intergenic
914289466 1:146259675-146259697 CACATTTGGATTTATGGCTCAGG - Intergenic
914550502 1:148710428-148710450 CACATTTGGATTTATGGCTCAGG - Intergenic
916106491 1:161436437-161436459 CAAATTATGCATTCTGGCACTGG + Intergenic
916187530 1:162147514-162147536 CACATTATGATTCGTGTACCAGG + Intronic
918546188 1:185687110-185687132 CAAATTATGATTTCTAACACTGG + Intergenic
920809745 1:209271953-209271975 CACATTGGGATTTGTTGCATTGG + Intergenic
920856168 1:209664053-209664075 CACATTATCATTGGCAGCACAGG - Intergenic
921595091 1:217046045-217046067 GACATTATGTTTTTTAGCACTGG - Intronic
924356853 1:243187570-243187592 CACATTAAAATTTGTAGCCCAGG - Intronic
1067005784 10:42660396-42660418 CACATTAGGAAATGTGACACTGG + Intergenic
1069192463 10:65507514-65507536 CAAATTATGCATTCTGGCACTGG + Intergenic
1072028497 10:91491039-91491061 CACATTTTGATTTGTGAAAATGG - Intronic
1073557190 10:104464754-104464776 CAAATTATGCATTCTGGCACTGG - Intergenic
1075192100 10:120319018-120319040 CAGATTATGATCAGAGGCACAGG + Intergenic
1079996971 11:27305132-27305154 CTCATTCTGGTTTGTGGAACTGG - Intergenic
1080703483 11:34666316-34666338 GACTTTATGATTTTTGACACTGG + Intergenic
1081220982 11:40461175-40461197 TACATTATTATTAGTGGCAAGGG + Intronic
1082999467 11:59278387-59278409 CCAATTATGCATTGTGGCACTGG - Intergenic
1085646849 11:78229573-78229595 CACATTATGATTTCTGCCCAGGG + Intronic
1086687706 11:89752086-89752108 CACAGAATCATTTGTGACACTGG - Intergenic
1086718145 11:90087809-90087831 CACAGAATCATTTGTGACACTGG + Intergenic
1092059106 12:5534179-5534201 CACATTATGATTTGTGGCACTGG - Intronic
1092831982 12:12452958-12452980 CATATCTTGATTTGTGGCAATGG + Intronic
1094435044 12:30412239-30412261 CAAATTATGAGTTGAGGCTCTGG + Intergenic
1094467413 12:30768248-30768270 GACATAATGACTGGTGGCACTGG - Intergenic
1094557393 12:31514833-31514855 AAAATTAAGATTTGTGACACTGG + Intronic
1097564800 12:61253604-61253626 CCAATTATGCATTGTGGCACTGG + Intergenic
1098579586 12:72083396-72083418 CACTTGATTATTTGTGGAACTGG + Intronic
1099296085 12:80829747-80829769 CACATTATTATTTGGGGAAGGGG - Intronic
1102765303 12:115427787-115427809 CACATGATGTTTTGTGCCACAGG - Intergenic
1103140436 12:118543392-118543414 CACATTATGATTTGTTTTTCAGG - Intergenic
1106590018 13:31090895-31090917 CACGTCATGATTTTTGGCTCAGG - Intergenic
1107543066 13:41411415-41411437 CAAATTGTGATCTGTGTCACTGG - Intergenic
1114219744 14:20685478-20685500 GACATCATTATCTGTGGCACAGG + Intronic
1115845203 14:37523856-37523878 CAGATTAAGATTTGTGGTAAGGG + Intronic
1116510608 14:45741957-45741979 CACATTTTGATTTGTACCAATGG - Intergenic
1117001435 14:51375128-51375150 CCCATTATGCATTCTGGCACTGG - Intergenic
1117431321 14:55665531-55665553 CACAACATAATTTATGGCACTGG - Intronic
1117763280 14:59055362-59055384 CACATTTTTATTTGTGGTAATGG + Intergenic
1121817968 14:96943018-96943040 CACATTATAATTGGGGGCACTGG - Intergenic
1122475796 14:102008093-102008115 AACATACTGATTTGTGGCAAGGG + Intronic
1202890961 14_KI270722v1_random:157084-157106 CTCTTTAAGATTTGGGGCACAGG - Intergenic
1124070860 15:26392044-26392066 CACATTAAGATTTCTGGCAATGG - Intergenic
1128758947 15:70201954-70201976 CACATGATGGTCTGTGGCTCAGG + Intergenic
1136250788 16:29003400-29003422 CAAATTATGCATTCTGGCACTGG - Intergenic
1144157658 17:12522593-12522615 CATAGTATGATTTTTGTCACAGG - Intergenic
1146947437 17:36883563-36883585 CACGTCATCATTTGTGGCAGAGG + Intergenic
1149207736 17:54267836-54267858 CTCAATTTGATTTGTGGCAAAGG - Intergenic
1156420997 18:36952905-36952927 CACATGATAATTTGTGGTAGAGG + Intronic
1158284830 18:55868636-55868658 CACAGTATTATTTGTGGGACAGG + Intergenic
1164312631 19:24059622-24059644 TACATTATGTATTTTGGCACTGG + Intronic
1164562282 19:29300441-29300463 CAGCTCATGATTTGAGGCACTGG + Intergenic
1165185008 19:34011498-34011520 GACATTCTAATTTATGGCACTGG - Intergenic
1202666382 1_KI270708v1_random:123922-123944 CTCTTTAAGATTTGGGGCACAGG - Intergenic
928085369 2:28342966-28342988 CACATTAGGAACTGTGGGACAGG - Intergenic
938180661 2:129179223-129179245 CCCATTTTGATCTGTGGGACTGG + Intergenic
940276622 2:151946958-151946980 CACACCAGGATTTATGGCACAGG - Intronic
941766218 2:169299675-169299697 TACATCATGTTTAGTGGCACGGG + Intronic
943387992 2:187225968-187225990 CCAATTATGCTTTCTGGCACTGG - Intergenic
944761804 2:202823478-202823500 CACATTTTCATTTCTGTCACAGG + Intronic
946698838 2:222389230-222389252 AACATTATAATTTGAAGCACTGG - Intergenic
946703943 2:222438966-222438988 CCAATTATGCTTTCTGGCACTGG + Intronic
947275188 2:228383212-228383234 CACCTTATGCTTTATGTCACAGG + Intergenic
949052353 2:241903973-241903995 CACCTTGTGCTTTGTGGCAGGGG - Intergenic
1171800154 20:29605083-29605105 CAGATTAAGATGTGTGTCACAGG + Intergenic
1174206373 20:48842878-48842900 TATATTATGATTAGTGGCTCAGG - Intergenic
949148814 3:739264-739286 CAGTTTATGTTTTGGGGCACCGG - Intergenic
949782587 3:7706819-7706841 CACATTGTGAGTTATGGCAGAGG - Intronic
954907280 3:54073477-54073499 CACATTATTAGCTGTTGCACTGG - Intergenic
957110857 3:75955125-75955147 CATTTTATGGTTTGTGTCACTGG + Intronic
958519831 3:95170248-95170270 CACATATTCATTTGTGGAACTGG - Intergenic
958692531 3:97485935-97485957 AACATTATGATTTCAGACACTGG - Intronic
963453569 3:145515929-145515951 CAAATTATGCATTCTGGCACTGG - Intergenic
966981439 3:185139686-185139708 CACAATATGATTTTTGACAAGGG + Intronic
968152673 3:196350241-196350263 AACATGATGATTTTTGGCACAGG - Exonic
971919307 4:32915862-32915884 CACATTGTAACTTGTGGAACAGG - Intergenic
972913808 4:43850902-43850924 CACATTGTGATTCGAAGCACAGG - Intergenic
974887889 4:67842977-67842999 CACATTTTGAGTTGTGTCAGTGG - Intronic
975485414 4:74930128-74930150 AACATTGTGATATGTGCCACAGG - Intergenic
982937574 4:161502247-161502269 TCCACTATGATTTGTTGCACTGG + Intronic
984293447 4:177824363-177824385 TATATTATGAGTTGTGTCACTGG - Intronic
987472573 5:18351285-18351307 CAGTTTATGATGGGTGGCACAGG - Intergenic
988079977 5:26402590-26402612 CCAATTATGCATTGTGGCACTGG + Intergenic
988092458 5:26561439-26561461 CCCATTATGCATTCTGGCACTGG - Intergenic
988525819 5:31986317-31986339 CATATTCTGATTTTTGGCCCCGG + Intronic
989050015 5:37310145-37310167 CAAGTTCTGATTTGTTGCACAGG - Intronic
991711813 5:69415540-69415562 CACAATGAGATTTGTGGGACCGG + Intronic
995438555 5:112164463-112164485 CACATTTTCATTTCTGGAACAGG - Exonic
996532298 5:124539103-124539125 CACATTAGTATTTGTGGCCCTGG + Intergenic
996991529 5:129638078-129638100 CATATGAAGATTTGTGACACAGG - Intronic
999725490 5:154433632-154433654 CACATAATTATTTGGGCCACTGG - Intergenic
1000592765 5:163178353-163178375 CAAATTATTATTTGGGGCTCAGG - Intergenic
1000978609 5:167792420-167792442 CCCATTATTGTTTGTAGCACAGG + Intronic
1005643298 6:27817110-27817132 CAGACAATGATTTGTGGCAAAGG + Intergenic
1009891322 6:69686773-69686795 CTCATTATGATCTGTATCACAGG + Intronic
1018123085 6:160656396-160656418 CAAATTATGCATTTTGGCACTGG + Intronic
1019022397 6:168930411-168930433 CACAGTTTGTTTTTTGGCACAGG - Intergenic
1022652839 7:32293085-32293107 CACAGTATGATTTCAGGCAAAGG + Intronic
1023769721 7:43545425-43545447 CACATTCTTATTTTTAGCACTGG - Intronic
1024344694 7:48301140-48301162 CTCCTTAAGATTTGTGGCGCGGG - Intronic
1030735698 7:113045585-113045607 CACATTGTGATATGTGGCCCAGG + Intergenic
1033991122 7:147288094-147288116 CACATGATGATTTGATGCAAAGG - Intronic
1034524209 7:151645879-151645901 TAAATTATGATATGTGGCAAGGG + Intronic
1041928169 8:63259181-63259203 CACATTATTTTCTGTGGCTCCGG + Intergenic
1042641649 8:70942045-70942067 CAAATCATGATTTCTGTCACTGG + Intergenic
1043323479 8:79020162-79020184 CAAATTATTATTTTTGGCATAGG - Intergenic
1044059755 8:87621385-87621407 CACAGTGTGATTTGTGACAATGG + Intergenic
1045355886 8:101388755-101388777 CACATTTTTATTTGTGGTGCAGG + Intergenic
1045772652 8:105761634-105761656 CACAAGATGATTTGACGCACGGG + Intronic
1049926880 9:418122-418144 CACATTCTGGTTAATGGCACCGG - Exonic
1050967698 9:11828389-11828411 GACATTATGATTTGTTGCAAGGG - Intergenic
1054841474 9:69745875-69745897 CCCAATATCATTTGTGGAACTGG - Intronic
1056301361 9:85245117-85245139 CACAGTAGGATTTGTGTGACTGG + Intergenic
1058605967 9:106723601-106723623 TACATTAAGATTTGGGGAACTGG - Intergenic
1061234049 9:129332216-129332238 CACAGTCTGTTTTGTGGCTCAGG - Intergenic
1203488068 Un_GL000224v1:76259-76281 CTCTTTAAGATTTGGGGCACAGG - Intergenic
1203500689 Un_KI270741v1:18152-18174 CTCTTTAAGATTTGGGGCACAGG - Intergenic
1186257099 X:7733522-7733544 CACATTTTCATTTTTGTCACAGG - Intergenic
1186852811 X:13597129-13597151 CAAATAATGATTTGTGTCAACGG + Intronic
1192349799 X:70348022-70348044 CTCATGATGATTTGTAGTACTGG - Intronic
1193832793 X:86308939-86308961 CCAATTATGAATTCTGGCACTGG - Intronic
1201851395 Y:18485806-18485828 CAGATTATGCTCTGTGGCCCAGG - Intergenic
1201881924 Y:18834573-18834595 CAGATTATGCTCTGTGGCCCAGG + Intergenic