ID: 1092059250

View in Genome Browser
Species Human (GRCh38)
Location 12:5535150-5535172
Sequence CTGTAGCTTTAGGAGAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 445}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092059244_1092059250 1 Left 1092059244 12:5535126-5535148 CCAAATACCCTTATTTATTCTGA 0: 1
1: 0
2: 0
3: 26
4: 270
Right 1092059250 12:5535150-5535172 CTGTAGCTTTAGGAGAGGGATGG 0: 1
1: 0
2: 3
3: 30
4: 445
1092059243_1092059250 22 Left 1092059243 12:5535105-5535127 CCTTTGGGTAGCTCTGGCTCTCC 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1092059250 12:5535150-5535172 CTGTAGCTTTAGGAGAGGGATGG 0: 1
1: 0
2: 3
3: 30
4: 445
1092059242_1092059250 25 Left 1092059242 12:5535102-5535124 CCACCTTTGGGTAGCTCTGGCTC 0: 1
1: 0
2: 2
3: 12
4: 178
Right 1092059250 12:5535150-5535172 CTGTAGCTTTAGGAGAGGGATGG 0: 1
1: 0
2: 3
3: 30
4: 445
1092059246_1092059250 -7 Left 1092059246 12:5535134-5535156 CCTTATTTATTCTGAGCTGTAGC 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1092059250 12:5535150-5535172 CTGTAGCTTTAGGAGAGGGATGG 0: 1
1: 0
2: 3
3: 30
4: 445
1092059245_1092059250 -6 Left 1092059245 12:5535133-5535155 CCCTTATTTATTCTGAGCTGTAG 0: 1
1: 0
2: 3
3: 31
4: 294
Right 1092059250 12:5535150-5535172 CTGTAGCTTTAGGAGAGGGATGG 0: 1
1: 0
2: 3
3: 30
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092059250 Original CRISPR CTGTAGCTTTAGGAGAGGGA TGG Intronic
900843539 1:5077614-5077636 TTGTAGGATTAGGAGAGTGAGGG - Intergenic
901446942 1:9314309-9314331 TTGTATATTTAGGAGCGGGAGGG - Intronic
901518527 1:9765705-9765727 TTGTATTTTTAGTAGAGGGAGGG - Intronic
901753982 1:11429735-11429757 CTGTGGCTGCAGTAGAGGGAGGG - Intergenic
903779934 1:25814624-25814646 CAGCAGCTTTGGGAGATGGATGG + Intronic
904228075 1:29041305-29041327 TTGTACCTTTAGTAGAGGCAGGG - Intronic
905283471 1:36864197-36864219 CTGGAAGTTTAGGAGAGGGTTGG + Intronic
907195476 1:52683055-52683077 TTGTATCTTTAGTAGAGAGAGGG + Intergenic
907886765 1:58599180-58599202 CTGTATTTTTAGGAGAGACAAGG + Intergenic
907916503 1:58874781-58874803 CTTCAGTTTTAGGGGAGGGAAGG + Intergenic
910289225 1:85583581-85583603 ATGTAGCTTTTGGGGAGGGAGGG + Exonic
910681624 1:89871449-89871471 GTATATTTTTAGGAGAGGGAAGG - Intronic
910869499 1:91819738-91819760 CTGTGGATTTAGGGGAGGGAGGG - Intronic
910886281 1:91966894-91966916 CTGTAGTTTTAGTAGAGACAGGG - Intronic
911096385 1:94058532-94058554 TTGTATTTTTAGGAGAGGCAGGG + Intronic
913049905 1:115108531-115108553 CTGTAGCTTTCAGAGAGATAAGG - Intergenic
913057237 1:115174005-115174027 TTCTATCTGTAGGAGAGGGATGG + Intergenic
913449667 1:118984579-118984601 CTGTTGCTCTGGGAGAGGGCGGG + Intronic
913512496 1:119574276-119574298 CTGTAGCTTGATGGGGGGGAGGG + Intergenic
914756448 1:150564251-150564273 CTTTAGCTTTAGTAGAGGGTTGG + Intergenic
915831476 1:159134875-159134897 ATGAAGCTTTTGTAGAGGGAGGG - Intronic
915851613 1:159330153-159330175 TTGTAGTTTTAGTAGAGAGAGGG - Intergenic
915964569 1:160295028-160295050 CAGTAGCTTTCACAGAGGGAGGG + Intronic
916073847 1:161188593-161188615 CTGATGCCTGAGGAGAGGGAGGG - Exonic
916851960 1:168712980-168713002 CTGCAGAGTTATGAGAGGGAGGG + Intronic
916911289 1:169350016-169350038 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
917561018 1:176155780-176155802 TACTAGCTTTAGGAGAAGGATGG + Intronic
917581037 1:176378185-176378207 TTGTTGCTTTAGGATAGGCATGG - Intergenic
917760075 1:178147314-178147336 TTGTATTTTTAGTAGAGGGAGGG - Intronic
917869392 1:179228918-179228940 TGGCAGCTTCAGGAGAGGGAAGG - Intronic
920192367 1:204201806-204201828 CAGCAGCTGTAGGGGAGGGAGGG + Exonic
921314492 1:213877484-213877506 CTGAAGCTTTGGGAAAGGGTGGG - Intergenic
921748937 1:218770059-218770081 CTGTTTCTTTAGGATAGTGAAGG - Intergenic
921754258 1:218835183-218835205 ATGTAGCTTCAGGTGAGGGTTGG - Intergenic
921858504 1:220015288-220015310 TTGTAGCTTTAGTAGAGGCAGGG - Intronic
922215221 1:223514890-223514912 CTATGGCTTTAGAAGAGGGCAGG - Intergenic
924031854 1:239893654-239893676 CTGTAGCAGTAGCAGAGGAAAGG + Intronic
1064326507 10:14356177-14356199 CAGTAGCATCAGGAGAGAGAAGG + Intronic
1064434539 10:15299802-15299824 CTGTATTTTTAGGAGAGACAGGG - Intronic
1065931720 10:30485359-30485381 TTGTAGTTTTAGTAGAGGTAGGG + Intergenic
1065977782 10:30858463-30858485 CAGTAGCTTGGGGAGAGGGTAGG - Intronic
1066538744 10:36421060-36421082 TTGTATTTTTAGGAGAGAGAGGG + Intergenic
1068178363 10:53491218-53491240 TTGTAGTTTTAGTAGAGGCAGGG - Intergenic
1068293620 10:55037404-55037426 TTGTAGTTTTAGGAGAGACAGGG + Intronic
1068624832 10:59231578-59231600 CAGAAGCTATAGGAGATGGAAGG + Intronic
1069509500 10:69031167-69031189 TTGTAGTTTTAGGAGAGATAGGG + Intergenic
1070042701 10:72797396-72797418 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1070612764 10:77945175-77945197 CTGTAGTTTTAGTAGAGACAGGG - Intergenic
1071280617 10:84099359-84099381 GTGTATCTTTAGTAGAGAGAGGG - Intergenic
1071541999 10:86493827-86493849 TTGTATTTTTAGTAGAGGGAGGG - Intronic
1074226961 10:111494092-111494114 CTCTTGCTTGAGGAGAGGAAAGG - Intergenic
1076213281 10:128670083-128670105 TTGTATTTTTAGGAGAGAGAGGG + Intergenic
1076946732 10:133656684-133656706 TTGTAGCTTCAGGTGAGGGGAGG - Intergenic
1077537274 11:3130440-3130462 CTGTGGCTTCAGGAGTGGGCTGG + Intronic
1077955438 11:7014611-7014633 CTGCCCCTTTAGGAGAGGGGTGG + Intronic
1078558441 11:12350333-12350355 CTGTGGCTTTAAGAGAATGAAGG + Intronic
1080024181 11:27596517-27596539 CTGAAGCTTTAGGAAAGGGAGGG - Intergenic
1080331352 11:31143366-31143388 ACATAGCTTTGGGAGAGGGAGGG + Intronic
1080473602 11:32569991-32570013 CTGTATTTTTAGTAGAGGCAGGG + Intergenic
1080853367 11:36090760-36090782 CTGTGTCTGTAGGAGAGGAAAGG - Intronic
1081468150 11:43344360-43344382 CTATTGCCTTAGGAAAGGGAAGG - Intronic
1081977297 11:47243793-47243815 CTATTCATTTAGGAGAGGGAGGG + Intronic
1083106598 11:60364321-60364343 CTGTCACTATAGGAGAAGGAAGG + Intronic
1083285708 11:61657404-61657426 TTGTAGTTTTAGGAGAGACAGGG - Intergenic
1084131900 11:67142476-67142498 CTGTATTTTTAGTAGAGGCAGGG - Intronic
1085194798 11:74662577-74662599 CTTCTGCTTGAGGAGAGGGAAGG - Intronic
1085404561 11:76254316-76254338 CTGAAGCCCTTGGAGAGGGAGGG + Intergenic
1086420309 11:86631903-86631925 TTGTATTTTTAGGAGAGAGAGGG + Intronic
1087415668 11:97852373-97852395 CAGTAGCTTTTGGAAAGGGTCGG + Intergenic
1087431125 11:98056727-98056749 CTGGAGCTTTATGTGTGGGAAGG + Intergenic
1088229967 11:107663530-107663552 CTGTAAATATAGGAGAAGGAGGG - Intronic
1088485240 11:110334112-110334134 CTGTATTTTTAGTAGAGGCAGGG + Intergenic
1089019340 11:115196421-115196443 CTGGAGCTTTAGGAGACAAATGG + Intronic
1089483461 11:118826434-118826456 TTGTAGCTTTAGTAGAGATAGGG - Intergenic
1089717122 11:120371314-120371336 CTGTATTTTTAGGAGAGACAGGG - Intronic
1089719789 11:120404844-120404866 CTGTTGAGGTAGGAGAGGGAGGG - Intronic
1090035504 11:123246275-123246297 CTCTGGCTTTGGGAGTGGGATGG + Intergenic
1091492527 12:945605-945627 CTGTACTTTTAGTAGAGGCAGGG + Intronic
1091505661 12:1065171-1065193 TTGTATTTTTAGTAGAGGGAGGG + Intronic
1092059250 12:5535150-5535172 CTGTAGCTTTAGGAGAGGGATGG + Intronic
1093037013 12:14341712-14341734 CTGTAGTTTTAGAAAGGGGAAGG - Intergenic
1093142522 12:15525715-15525737 CTCTAGCTGTAGGAGAGGATGGG + Intronic
1093506385 12:19871633-19871655 TTGTATCTTTAGGAGAGACAGGG + Intergenic
1094546022 12:31405388-31405410 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1095374633 12:41511972-41511994 CTATAGCTCTAGGAGCGGGATGG + Intronic
1095573874 12:43712644-43712666 CTGAAACTTGAGAAGAGGGAGGG + Intergenic
1095870898 12:47026924-47026946 CTGTAGTTTTAGTAGAGGCGGGG - Intergenic
1096665666 12:53162393-53162415 TTGTAGTTTTAGGAGAGACAGGG - Intronic
1098387639 12:69935692-69935714 CTGTCGCATTGGGAGATGGAAGG - Intronic
1098964533 12:76772858-76772880 TTGTTTCTTTGGGAGAGGGATGG + Intronic
1099243444 12:80165712-80165734 CTGTAGCTGTAGGAAAGGTCTGG - Intergenic
1100921479 12:99493232-99493254 CTGTATCTTTAGCAGATGCAAGG + Intronic
1100975768 12:100121173-100121195 CTGTATTTTTAGTAGAGGCAGGG - Intronic
1101061344 12:100975611-100975633 CTGTATTTTTAGTAGAGAGAGGG + Intronic
1101346756 12:103892950-103892972 CTGTGGCTTCAGGAGAAGGTAGG - Intergenic
1101442154 12:104711930-104711952 GTTTAGCTTTATGGGAGGGACGG + Intronic
1102873952 12:116435380-116435402 TTGTAGTTTTAGGAGAGACAGGG + Intergenic
1103172890 12:118836818-118836840 CTGTAGTTGTAGGGGAGGAAAGG - Intergenic
1103355445 12:120316470-120316492 CTGTATTTTTAGTAGAGGCAGGG - Intergenic
1104456455 12:128917447-128917469 CTGTATTTTTTGGAGAGAGAGGG + Intronic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1105834746 13:24199632-24199654 GTGTAGGTTTAGGAGAGGGATGG + Intronic
1106034041 13:26027777-26027799 TTGTAGCTTTAGTAGGTGGAAGG - Intergenic
1106284243 13:28305395-28305417 CTGTAGTTTTAGTAGAGAAAGGG + Intronic
1108223926 13:48268059-48268081 AAGTAGTTTTAGCAGAGGGAAGG - Exonic
1109804525 13:67421072-67421094 CAGAAGCTTTGGGAGAGGGAGGG + Intergenic
1109957793 13:69591033-69591055 CTGTATTTTTAGAAGAGGCAGGG + Intergenic
1110646143 13:77886856-77886878 CTGGAGCTCCAGGAGAGGGTTGG + Intergenic
1111364268 13:87221209-87221231 TTGTAGTTTTAGTAGAGAGAGGG - Intergenic
1112395676 13:99028542-99028564 TTCTTGCTTTTGGAGAGGGAGGG + Intronic
1112452622 13:99525925-99525947 GTGATGATTTAGGAGAGGGAAGG + Intronic
1113397379 13:109961253-109961275 GTGCAGCCTTGGGAGAGGGAAGG + Intergenic
1116871311 14:50071238-50071260 CTGTAAAATTAGGAGAGGGTGGG - Intergenic
1117258795 14:54007547-54007569 TTGTATTTTTAGTAGAGGGAGGG + Intergenic
1118109341 14:62698357-62698379 TTGTATTTTTAGTAGAGGGAGGG + Intergenic
1118503618 14:66387241-66387263 CTGTATTTTTAGTAGAGGCAGGG - Intergenic
1118954586 14:70468469-70468491 TTGTATTTTTAGGAGAGAGAGGG - Intergenic
1119432231 14:74575916-74575938 CTGTGGGTTTGGAAGAGGGAGGG - Intronic
1120141574 14:80935376-80935398 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1120872948 14:89354396-89354418 CTGTACTTTTAGGAGAGACAGGG + Intronic
1121085673 14:91144385-91144407 CTGTATCTTTAGTAGAGACAAGG - Intronic
1121197216 14:92084750-92084772 TTGTATTTTTAGGAGAGGCAGGG + Intronic
1121201761 14:92123298-92123320 TTGTAGCTTTAGTAGAGACAGGG + Intronic
1122036897 14:98955626-98955648 GTGTGGATGTAGGAGAGGGAAGG + Intergenic
1122198110 14:100104946-100104968 CTGTAGCTGAAGGAGAAGAAGGG + Intronic
1122241336 14:100369834-100369856 TTGTATTTTTAGTAGAGGGAGGG + Intronic
1122728276 14:103775445-103775467 TTGTATCTTTAGTAGAGAGAGGG + Intronic
1124041076 15:26104004-26104026 TTGTAGTTTTAGTAGAGGCAGGG - Intergenic
1124524334 15:30434858-30434880 CTGTATTTTTAGGAGAGACAGGG + Intergenic
1124534331 15:30531365-30531387 CTGTATTTTTAGGAGAGACAGGG - Intergenic
1124764317 15:32476246-32476268 CTGTATTTTTAGGAGAGACAGGG + Intergenic
1124774317 15:32572852-32572874 CTGTATTTTTAGGAGAGACAGGG - Intergenic
1124897324 15:33789149-33789171 GTGTAGCTGAAGCAGAGGGAGGG + Intronic
1125525488 15:40371471-40371493 CTGTGGCTGTAGAAGAGGCACGG - Intergenic
1125816711 15:42591313-42591335 CTGTATCTTTAGTAGAGACAGGG - Intronic
1126103778 15:45135008-45135030 TTGAAGCTTCAGGGGAGGGAAGG + Intronic
1126810753 15:52401240-52401262 TTGTATCTTTAGTAGAGAGAGGG + Intronic
1127419026 15:58787000-58787022 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1127461639 15:59204649-59204671 CTGTAGGGGTAGAAGAGGGAGGG - Intronic
1129421856 15:75434475-75434497 TTGTATTTTTAGTAGAGGGAGGG - Intronic
1129465170 15:75720722-75720744 TTGTATTTTTAGGAGAGGCAGGG - Intergenic
1129690626 15:77711307-77711329 CTGTGGCTTAAAGAGAGGCATGG + Intronic
1130200078 15:81817499-81817521 CTGTACAATTAGGAGTGGGATGG + Intergenic
1130967957 15:88711079-88711101 TTGTACCTTTAGTAGAGGTAGGG + Intergenic
1131514923 15:93071044-93071066 CTGCAGCTTTAAGAGCGGGAAGG + Intronic
1131740404 15:95384307-95384329 CTGTATTTTTAGTAGAGGCAGGG - Intergenic
1132042255 15:98535308-98535330 TTGTAGTTTTAGTAGAGGGGGGG - Intergenic
1132146055 15:99430590-99430612 TTGTAGCTTTAGTAGAGACAGGG - Intergenic
1132366876 15:101264262-101264284 CTGTAGTTGTAGGAGAGAAATGG + Intergenic
1132746876 16:1439974-1439996 CTGTAGTTTTAGTAGAGACAGGG - Intronic
1133077230 16:3289250-3289272 CTTTACCTTTAGGAGAGGATGGG + Intronic
1133783157 16:8954784-8954806 TTGTATCTTTAGTAGAGGGGGGG - Intronic
1134095043 16:11413467-11413489 CTGTGGCTCTTGGAGAAGGAGGG + Intronic
1134246278 16:12542502-12542524 TTGTATTTTTAGGAGAGGCAGGG + Intronic
1134652965 16:15925384-15925406 CTGTATCTTTAGTAGAGACAGGG - Intergenic
1135143269 16:19939832-19939854 CTGTTGCTTTTGGAGAGCAAAGG + Intergenic
1135230281 16:20699911-20699933 CTTTAGCTTTAAGAGAGGTTGGG - Intronic
1135418818 16:22290296-22290318 CTGTATTTTTAGTAGAGGCAGGG + Intergenic
1135520372 16:23172276-23172298 TTGTAGTTTTAGTAGAGGTAGGG + Intergenic
1135579712 16:23615119-23615141 CTGTATTTTTAGTAGAGGCAGGG + Intronic
1135620934 16:23954877-23954899 CTGTAGTTTTAGTAGAGACAGGG - Intronic
1136086588 16:27889741-27889763 TTGAAGCTGTAGGACAGGGAAGG - Intronic
1137431736 16:48423681-48423703 CTGTAGTTTTAGTAGAGACAGGG + Intronic
1138206754 16:55130996-55131018 GGGAAGCTTTAGGAGAGGGTGGG - Intergenic
1138471380 16:57240762-57240784 CTGTACATTTAGTAGAGAGAGGG + Intergenic
1138496459 16:57412011-57412033 CTGTGGCTTGAGGAGGGGGCAGG + Intronic
1139760753 16:69182960-69182982 CAGTTGATTTAGGAGAGGGCTGG + Intronic
1140080622 16:71743771-71743793 TTGTAGTTTTAGGAGAGACAGGG - Intronic
1140444722 16:75016410-75016432 CTGTAGTTTTAGTAGAGACATGG + Intronic
1141112919 16:81285010-81285032 TTGTATTTTTAGTAGAGGGAGGG + Intronic
1143248852 17:5507520-5507542 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1143480455 17:7224941-7224963 CTGCAGCCTGGGGAGAGGGAAGG - Exonic
1143919549 17:10320038-10320060 CTCTAGCTTTAGCAGGAGGAAGG + Intronic
1145029325 17:19492683-19492705 TTGTTGCTTTAGTGGAGGGATGG - Intergenic
1145192178 17:20852347-20852369 TTGTAGCTTCAGGAGCGGGGAGG + Intronic
1146299070 17:31674071-31674093 TGGTAGCTTTTGGAGAGGCAAGG + Intergenic
1146583105 17:34057512-34057534 CTGGAGCTTTAGTAGGAGGACGG + Intronic
1146686161 17:34842918-34842940 CTGTGGGGCTAGGAGAGGGATGG - Intergenic
1146851345 17:36224460-36224482 TTGTATCTTTAGTAGAGGCAGGG + Intronic
1147070133 17:37948944-37948966 TTGTATCTTTAGTAGAGGCAGGG + Intergenic
1147081654 17:38028470-38028492 TTGTATCTTTAGTAGAGGCAGGG + Intronic
1147097605 17:38152440-38152462 TTGTATCTTTAGTAGAGGCAGGG + Intergenic
1147369843 17:39984771-39984793 CTGTTGTTCTAGGAGAGAGAAGG + Intronic
1147759635 17:42789074-42789096 CTGTGGCTGTAGGTGAAGGATGG + Intronic
1148659905 17:49321446-49321468 TTGTATTTTTAGGAGAGGCAGGG + Intronic
1148668787 17:49394688-49394710 TTGTATCTTTAGGAGAGACAGGG + Intronic
1149329042 17:55562580-55562602 TTGTATCTTTAGTAGAGGCAGGG - Intergenic
1149702301 17:58665426-58665448 CTGTATTTTTAGTAGAGGCAGGG - Intronic
1150554988 17:66246232-66246254 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1151253842 17:72859812-72859834 TTGTAGCTTTAGTAGAGACAGGG - Intronic
1153441290 18:5122403-5122425 CTGCAGCTTGACGTGAGGGAGGG + Intergenic
1153599269 18:6763059-6763081 CAATAACTTTATGAGAGGGATGG + Intronic
1153759891 18:8320309-8320331 CTGGACCGTGAGGAGAGGGAAGG + Intronic
1154281923 18:13011052-13011074 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1154939746 18:21099861-21099883 TTGTATCTTTAGTAGAGGTAGGG - Intronic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157317736 18:46606991-46607013 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1157483340 18:48069908-48069930 CTGGAGCGGGAGGAGAGGGAAGG + Intronic
1157670667 18:49525857-49525879 CTATAGCTGTAGGACAGGGGTGG - Intergenic
1158264427 18:55645585-55645607 TTGTATTTTTAGGGGAGGGAGGG - Intronic
1158425672 18:57337952-57337974 CTGCAGCTTTGGGAGAGAGGAGG - Intergenic
1159053246 18:63441262-63441284 CTGAAGCCGTAGGAGAGAGAAGG - Intergenic
1159907234 18:74105618-74105640 TTGTATTTTTAGGAGAGGTAGGG + Intronic
1160165894 18:76512039-76512061 TTGTATCTTTAGTAGAGGCAGGG - Intergenic
1161784685 19:6316644-6316666 TTGTATCTTTAGTAGAGGCAAGG - Intronic
1162082800 19:8228849-8228871 CTGTATTTTTAGGAGAGACAAGG - Intronic
1163323419 19:16587708-16587730 CTGTGGCTGCAGGACAGGGAGGG - Intronic
1163338759 19:16690503-16690525 TTGTAGTTTTAGTAGAGGCAGGG - Intergenic
1164177150 19:22785159-22785181 CTCTGACCTTAGGAGAGGGAAGG + Intergenic
1164189047 19:22898761-22898783 TTGTAGTTTTAGTAGAGGTAGGG + Intergenic
1164406688 19:27954390-27954412 CAGAAGCTTTAGGTTAGGGACGG + Intergenic
1164626331 19:29730960-29730982 CTGTATTTTTAGGAGAGACAGGG - Intergenic
1165239781 19:34456728-34456750 TTGTAGTTTTAGGAGAGACAGGG + Intronic
1165256194 19:34578432-34578454 CTGCAGCTGTAGGGGTGGGAGGG - Intergenic
1165274009 19:34732979-34733001 CTGTAGCTGTGGGCGTGGGAGGG + Intergenic
1165527463 19:36368294-36368316 CTGTATTTTTAGTAGAGGCAGGG - Intronic
1165846200 19:38819290-38819312 CTGTGGCTGTTGAAGAGGGAGGG - Intronic
1165859335 19:38899104-38899126 CGGTAGGTTTAGGAGAGGCGCGG + Intronic
1166104835 19:40592448-40592470 CTGTATTTTTAGTAGAGGCAGGG + Intergenic
1166917686 19:46206800-46206822 CTGCAGCTTCAGGAGAGGGGAGG + Intergenic
1167042292 19:47029254-47029276 CTGTAGTTTTAGTAGAGACAGGG + Intronic
1167458471 19:49611462-49611484 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1167873589 19:52393243-52393265 CTGTATTTTTAGTAGAGAGAGGG + Intergenic
925210014 2:2037463-2037485 CTGTAGCTTTGGGCCAGGGACGG + Intronic
926511429 2:13785090-13785112 TAGTTGCTTTAGGAGAGGGATGG - Intergenic
926630283 2:15129487-15129509 CTGTAGCTTTGGGACAGGGCAGG - Intergenic
927731442 2:25476239-25476261 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
929530648 2:42749638-42749660 TTGTAGTTTTAGGAGAGACAGGG + Intronic
930066174 2:47329335-47329357 TTGTAGTTTTAGTAGAGGCAGGG - Intergenic
930313319 2:49769559-49769581 TTGTAGTTTTAGTAGAGGCATGG + Intergenic
931600664 2:64000032-64000054 TTGTATCTTTAGTAGAGGCAGGG + Intronic
932052891 2:68416705-68416727 CTGCAGCTTGAGGAATGGGAGGG + Intergenic
932262932 2:70342195-70342217 CTATAACTTGAGAAGAGGGAAGG + Intergenic
932551586 2:72775300-72775322 AGATAGCTTTAGGAGAGGGAGGG - Intronic
933061265 2:77739916-77739938 TTGTAGTTTTAGTAGAGAGAGGG - Intergenic
933900617 2:86847107-86847129 TTGTATCTTTAGTAGAGAGAGGG + Intronic
934041269 2:88129428-88129450 CTGTGGCTTGAGGAGAAGGAAGG - Intergenic
935031490 2:99327242-99327264 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
935779932 2:106502121-106502143 TTGTATCTTTAGTAGAGAGAGGG - Intergenic
937784811 2:125884024-125884046 CTTTAGGTATAGGAGAGAGATGG - Intergenic
937808437 2:126172591-126172613 CTGTATTTTTAGCAGAGAGAGGG + Intergenic
938183405 2:129206006-129206028 TTGCAGCTAGAGGAGAGGGAAGG + Intergenic
939056748 2:137374140-137374162 CTGTGGCATGAGGGGAGGGAGGG + Intronic
940077582 2:149760309-149760331 CTGTATTTTTAGTAGAGAGAGGG + Intergenic
940931073 2:159432203-159432225 CTGTGGAATGAGGAGAGGGAAGG + Intronic
942772959 2:179545014-179545036 CTGTAGGTTTGGGAGGGAGATGG - Intronic
943023494 2:182601987-182602009 CCCTACCTTTAGGACAGGGAGGG - Intergenic
943195221 2:184737949-184737971 CTGTATTTTTAGTAGAGGCAGGG - Intronic
946053547 2:216882874-216882896 CTGTAGCTGATGGAGAGGGAAGG - Intergenic
946941654 2:224775646-224775668 TTGTAGTTTTAGTAGAGAGAGGG + Intronic
947633693 2:231669402-231669424 CTGTATTTTTAGCAGAGGCAGGG + Intergenic
947639281 2:231697328-231697350 TTGTATCTTTAGTAGAGGCAGGG + Intergenic
948907632 2:240987249-240987271 CTGGAGCCTGAGGAGGGGGAGGG + Intronic
1168799387 20:634575-634597 CTGCAGCTTGAGGAGGAGGAAGG + Intergenic
1169053520 20:2600503-2600525 TTGTATCTTTAGTAGAGGCAGGG - Intronic
1170609065 20:17896726-17896748 CTGAAGCTTTGGGAGATAGAGGG + Intergenic
1170635876 20:18103997-18104019 TTGTATCTTTAGTAGAGGTAGGG - Intergenic
1170941160 20:20849008-20849030 CTGTAACACTAGGAGAGTGAGGG + Intergenic
1172542267 20:35727958-35727980 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1172859857 20:38039904-38039926 TTGTATCTTTAGTAGAGGTAGGG + Intronic
1173307348 20:41863019-41863041 CTGATACTTTAGGAGAGGGTAGG - Intergenic
1173594873 20:44252336-44252358 CTGTATTTTTAGGAGAGACAGGG - Intronic
1173761918 20:45569214-45569236 TTCTCCCTTTAGGAGAGGGAGGG + Intronic
1175837966 20:62008450-62008472 CTGTGGGTTAAGGAGAGGGGAGG + Intronic
1176249360 20:64112918-64112940 CTGGAGATGTAGGAGAGGGCTGG + Intergenic
1178313754 21:31552599-31552621 CTGTATTTTTAGGAGAGGCAGGG - Intronic
1180577519 22:16793182-16793204 CTGTATTTTTAGTAGAGGCAAGG + Intronic
1180677768 22:17599745-17599767 TTGTATTTTTAGTAGAGGGAGGG - Intronic
1180895279 22:19327209-19327231 TTGTAGTTTTAGTAGAGGCAGGG + Intergenic
1182867518 22:33617014-33617036 CTGTGTATTTGGGAGAGGGAAGG + Intronic
1184082715 22:42235414-42235436 CTGTCACTTCAGGAGAGAGATGG - Intronic
1184121518 22:42453531-42453553 TTGTATCTTTAGGAGAGACAGGG + Intergenic
1184577792 22:45387273-45387295 CTGTATTTTTAGTAGAGGCAGGG - Intronic
1184820319 22:46905094-46905116 CTGTGGCTTTCAGAGGGGGACGG + Intronic
1185081559 22:48712227-48712249 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
949102283 3:160348-160370 CTGTAGATTTAAGTGAGGCAAGG - Intergenic
949556529 3:5158154-5158176 CTGTATTTTTAGTAGAGGTAGGG + Intronic
949821141 3:8116506-8116528 CTGAAGATTGTGGAGAGGGATGG - Intergenic
950110654 3:10416724-10416746 CTCTGGCTTTATGAGAGGGAAGG + Intronic
950917879 3:16664084-16664106 GTGTGGCATTAGGAGATGGATGG + Intronic
951950491 3:28195205-28195227 CTATAACTATAGGAGAGGGTTGG - Intergenic
953059212 3:39413379-39413401 TTGTATCTTTTGGAGAGAGATGG - Intergenic
953567041 3:44041637-44041659 CGATTGCTTTTGGAGAGGGAGGG + Intergenic
953637300 3:44674054-44674076 CTGTAGCTTAGGGGGAGGAAAGG + Intergenic
954668667 3:52275709-52275731 TTGTATCTTTAGTAGAGGCAGGG - Intronic
955109397 3:55933034-55933056 TTGTAGTTTTAGTAGAGGCAAGG - Intronic
955557290 3:60151623-60151645 CTGAAGCTTTGTGAGAGAGAGGG - Intronic
955596002 3:60591272-60591294 CTGTAGTTTAATGAGAGTGAGGG - Intronic
955898476 3:63726289-63726311 CTGTAGTTTTAGTAGAGACAAGG - Intergenic
955994548 3:64666555-64666577 GAGTAGCTTTAGGGGAGGAATGG - Intronic
956717137 3:72088445-72088467 TTGTATCTTTAGTAGAGGCAGGG - Intergenic
958619507 3:96538442-96538464 CTGTAGTTTGAGGAGCAGGAGGG - Intergenic
958913033 3:100016361-100016383 TTGTATCTTTAGTAGAGGCAGGG + Intronic
959318102 3:104835246-104835268 TTATAGCTGTAGGAGAGGAAAGG + Intergenic
960606656 3:119512911-119512933 TTGTATCTTTAGTAGAGGCAGGG + Intronic
961930579 3:130528917-130528939 TTATAGTTTTAGGAGAGAGAGGG - Intergenic
962684043 3:137829255-137829277 CTGTAGCAAGAGGTGAGGGAGGG + Intergenic
962789346 3:138796876-138796898 CTTCAGCTTTGGGAGAGGCAGGG - Intronic
962988749 3:140559710-140559732 CAGTGGCTTTTGGAGGGGGAGGG - Intronic
963080326 3:141386113-141386135 ATTTAGCTTTTGGAGGGGGAGGG + Intronic
964205594 3:154171525-154171547 CAGGGGCTTAAGGAGAGGGAGGG - Intronic
964686720 3:159403875-159403897 CTTTAGCTTAAGGAGAGGAGAGG + Intronic
965192786 3:165552949-165552971 CTGTATTTGTAGTAGAGGGAGGG + Intergenic
965508432 3:169541636-169541658 CTGTTGCCTTAGAACAGGGAAGG - Intronic
965872758 3:173280574-173280596 TTGTAGCTTTTGGTGAGGGTCGG - Intergenic
965922846 3:173940259-173940281 TTGTATTTTTAGGAGAGGCAGGG + Intronic
966310108 3:178584435-178584457 CTTTTTCTTTTGGAGAGGGAGGG - Intronic
966569351 3:181423800-181423822 CTGTATTTTTAGTAGAGAGAGGG - Intergenic
966658120 3:182382916-182382938 CTGTACCATTAGAAGAGGAAGGG + Intergenic
967460374 3:189739286-189739308 TTGTATTTTTAGGAGAGGCAGGG + Intronic
967668822 3:192207433-192207455 CTGAAGCTTTTGCAGAAGGAGGG + Intronic
968333633 3:197893667-197893689 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
970473508 4:16400001-16400023 CTGGAGGTTTGGGAAAGGGATGG - Intergenic
972871769 4:43309231-43309253 CTGTACCTCTAGGACAAGGAAGG - Intergenic
972951072 4:44323319-44323341 TTGTATTTTTAGAAGAGGGAGGG - Intronic
973943481 4:55933595-55933617 TTGTAGTTTTAGGGGAGTGAAGG + Intergenic
974408770 4:61511183-61511205 TTGTATCTTTAGTAGAGAGAGGG - Intronic
975340403 4:73233295-73233317 CTATAAATTTAGGAGATGGAGGG - Intronic
975679224 4:76859141-76859163 TTGTATCTTTAGTAGAGGCAGGG - Intergenic
976045403 4:80940591-80940613 CTGTTGCTGTAGGGGAGTGAGGG + Intronic
976907846 4:90262690-90262712 CTGAAGTTTTAGCAGGGGGAAGG + Intronic
978605480 4:110475102-110475124 TTGTATCTTTAGGAGAGACAGGG + Intronic
980751084 4:137089672-137089694 CTGTTGCTTTAGGAGAATAAGGG - Intergenic
980783591 4:137523584-137523606 CTGTAGTTTTAGGCTTGGGAAGG + Intronic
980939085 4:139255580-139255602 CTGGATCTATAGGGGAGGGAAGG + Intergenic
981298322 4:143157952-143157974 CTCTCTCTTTAGTAGAGGGAGGG + Intergenic
981968027 4:150630099-150630121 AAGAAGCTTAAGGAGAGGGAGGG - Intronic
983456603 4:167972656-167972678 TTGTAGCTTGATGAGTGGGAGGG - Intergenic
984232831 4:177120046-177120068 CTGTAGATTTAGAAGATGGATGG - Intergenic
984946689 4:184974276-184974298 CTGTATTTTTAGTAGAGGCAGGG + Intergenic
985175405 4:187194930-187194952 CTGTAGTTTTGGGACAGGGGAGG + Intergenic
985450188 4:190057483-190057505 TTGTAGCTTCAGGTGAGGGGAGG - Intergenic
985944765 5:3170550-3170572 ATGGAGATTTAGGAGAAGGACGG - Intergenic
986092942 5:4528624-4528646 CTGTATTTTTAGTAGAGGCAGGG + Intergenic
986568654 5:9142392-9142414 CTGAAGCTTGAGGAGAGAAATGG + Intronic
988567976 5:32335492-32335514 ATGTATTTTTAGGAGAGTGAAGG + Intergenic
991276397 5:64852643-64852665 TTGTATCTTTAGGAGAGATAGGG + Intronic
991315644 5:65301914-65301936 CTGTATCTTTAGTAGAGACAGGG - Intronic
991559629 5:67935985-67936007 CTAAAGCTTTAGGAGACTGATGG + Intergenic
995678124 5:114686161-114686183 TTGTAGCTTTAGTAGAGACAGGG + Intergenic
997244204 5:132332380-132332402 CCATAACTTTAGGAGGGGGAAGG - Intronic
997330681 5:133058953-133058975 TTGTATCTTTAGTAGAGGCAGGG - Intronic
998847776 5:146327561-146327583 CTTCAGCTTTAGCAAAGGGAAGG - Intronic
998939592 5:147266849-147266871 TTGTATTTTTAGGAGAGGCAGGG - Intronic
999378548 5:151104027-151104049 CAATATCTTTAGAAGAGGGAGGG + Intronic
999627394 5:153535092-153535114 CTGTATCTTTAGTAGAGACAGGG + Intronic
1000446110 5:161323193-161323215 TTGTATCTTTAGCAGAGGCATGG + Intronic
1001186961 5:169583641-169583663 CAGTAGCTGTAGGAGGGGGTGGG + Exonic
1001245019 5:170099506-170099528 CTGAAGTCTTTGGAGAGGGAGGG + Intergenic
1002063036 5:176637714-176637736 CTGTGGCTGCAGCAGAGGGAGGG + Intronic
1003890931 6:10562984-10563006 CTGTATATTTAGTAGAGGTAGGG - Intronic
1004255003 6:14055456-14055478 CTGTACCTTTAGAAGAAGGGTGG - Intergenic
1004394034 6:15232693-15232715 TTGTATCTTTAGGAGAGGCAGGG + Intergenic
1004510807 6:16282979-16283001 CTGTAGTTTTAGTAGAGACAGGG + Intronic
1005311373 6:24562665-24562687 CTGTATTTTTAGTAGAGGCAGGG - Intronic
1005834807 6:29700580-29700602 TTGTAACTTTAGTAGAGGCAGGG + Intergenic
1005968179 6:30742198-30742220 CTGGAGCTGGAGGAGAGGGAGGG + Exonic
1006170309 6:32088230-32088252 CTGTAGCTGAAGGAGAGAAAGGG + Intronic
1006500609 6:34456684-34456706 TTGTATCTTTAGTAGAGGCAGGG + Intergenic
1006666418 6:35697719-35697741 CTGGAGGTGTAGGAGAGGGGAGG + Intronic
1007082505 6:39117809-39117831 CTGTAGCTATAGGAGAAGCAAGG + Intergenic
1007444934 6:41897545-41897567 CTGTATTTTTAGTAGAGAGAGGG - Intergenic
1007587761 6:43002335-43002357 TTGTATCTTTAGTAGAGGCAGGG + Intronic
1008237921 6:49072772-49072794 TTGTAGTTTTAGGAGAGAGGGGG - Intergenic
1008970068 6:57357104-57357126 TTGTAGCTTTAGTAGAGACAGGG + Intronic
1009159036 6:60258919-60258941 TTGTAGCTTTAGTAGAGACAGGG + Intergenic
1009202363 6:60761461-60761483 CTGTAACTTTTGGAGAGGGATGG + Intergenic
1009378275 6:62998409-62998431 TTGTATTTTTAGGAGAGGCAGGG - Intergenic
1009639785 6:66319052-66319074 CTGTATCTTTAGTATAGAGACGG + Intergenic
1011628822 6:89305180-89305202 CTGTAGTTTTAGTAGAGACAGGG - Intronic
1013360793 6:109392340-109392362 CTGTAGTTTTAGTAGAGACAGGG + Intronic
1013500559 6:110745508-110745530 CTGTAGCTTTAGGACTGATAAGG - Intronic
1013529362 6:111004739-111004761 CTGTAGTTTTAGTAGAGACAGGG + Intronic
1013899599 6:115138521-115138543 CTGTAGCTTTTTAAGAGGAAAGG - Intergenic
1013945824 6:115721067-115721089 CTGTTTGTTTAGGAGAGGGAAGG - Intergenic
1016000423 6:139035925-139035947 CTGTATCTTTAGTAGAGACAGGG - Intronic
1016729282 6:147410177-147410199 CTTTAGCTTAAGGGGAGGGTGGG + Intergenic
1017176350 6:151508363-151508385 TTGTATTTTTAGGAGAGGCAGGG - Intronic
1017211131 6:151857699-151857721 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1017960869 6:159219211-159219233 CTGTATTTTTAGTAGAGGCAAGG + Intronic
1018543274 6:164907331-164907353 CTGTAGTGGTAGGAGAGTGATGG - Intergenic
1021906670 7:25340814-25340836 CTGTATTTTTAGTAGAGAGAGGG + Intergenic
1022003821 7:26249189-26249211 CTGTAGCTTTTGATGAGGGTCGG - Intergenic
1022154873 7:27650235-27650257 CTGTAACTGTGGGAGTGGGAAGG - Intronic
1022287229 7:28965190-28965212 CTGCAGCTCTAGGGGAGGGAAGG - Intergenic
1022413366 7:30156650-30156672 TTGTAGTTTTAGGAGAGACAGGG - Intronic
1023067589 7:36393762-36393784 CTGTAGCTTGTGGAGCAGGAGGG + Intronic
1023667155 7:42535796-42535818 CAGGGGCTTGAGGAGAGGGAGGG - Intergenic
1026084317 7:67250561-67250583 TTGTAGTTTTAGTAGAGGCAGGG + Intergenic
1026210429 7:68299168-68299190 TTGTAGTTTTAGTAGAGGCAGGG + Intergenic
1026346024 7:69474908-69474930 TTGTAGTTTTAGTAGAGGCAGGG - Intergenic
1026692767 7:72563777-72563799 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1026804353 7:73420563-73420585 CTGTAGTTTTAGTAGAGACAGGG - Intergenic
1026942004 7:74292558-74292580 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1027229784 7:76265425-76265447 CTGTAGTGGGAGGAGAGGGAGGG - Exonic
1027397917 7:77775360-77775382 TTGTATTTTTAGGAGAGGCAAGG - Intronic
1027794558 7:82676159-82676181 GTGAAGAGTTAGGAGAGGGAAGG - Intergenic
1028410166 7:90522070-90522092 GTTTAGCTTAAGGAGAGGGAGGG + Intronic
1029559478 7:101293043-101293065 TTGTATTTTTAGTAGAGGGAGGG + Intergenic
1029709586 7:102292356-102292378 TTGTATTTTTAGGAGAGGCAGGG - Intronic
1029817674 7:103113435-103113457 CTGCATCTTTGGGAGAGGGCAGG + Intronic
1030001389 7:105067796-105067818 CTGTATTTTTAGGAGAGACAGGG - Intronic
1030393765 7:108960208-108960230 CTGTATCTTTATGTGAGGTAGGG - Intergenic
1030872824 7:114778333-114778355 TTGTAGTTTTAGTAGAGAGAGGG + Intergenic
1031041676 7:116844629-116844651 CTCTAGCTGTAGGAAAGGAATGG + Intronic
1031899351 7:127392501-127392523 CTCAGGCTTTAGGAGAGGGGCGG + Exonic
1034722735 7:153309623-153309645 CAGCAGCTTTAGGAGAGCAATGG - Intergenic
1035192358 7:157182611-157182633 CTGGAAATTTAGCAGAGGGAGGG - Intronic
1035210957 7:157327682-157327704 CTGTATTTTTAGTAGAGAGAAGG + Intergenic
1036172998 8:6508275-6508297 TTGTATTTTTAGTAGAGGGAGGG - Intronic
1036224659 8:6947530-6947552 CTTTGGCTTTAGGAGAGTGTAGG - Intergenic
1036800744 8:11789213-11789235 CTGTAGCTGTAGGAGTGGAGAGG + Intergenic
1037020673 8:13966402-13966424 CTCTAGCTTTAATAGAGGGAAGG - Intergenic
1037582339 8:20253107-20253129 CAGAAGCTGTTGGAGAGGGAGGG - Exonic
1038100144 8:24364294-24364316 TTGTATCTTTAGTAGAGGCAGGG + Intergenic
1038662751 8:29511330-29511352 TTGTTGCTTTAGGAAAGGGATGG + Intergenic
1039938564 8:42069132-42069154 TTGTATCTTTAGGAGAGACAGGG - Intergenic
1039959127 8:42231666-42231688 CTTTAGCTTTTGGAGAATGAGGG + Intergenic
1040489586 8:47907212-47907234 CTGTACCTTTAGTAGAGACAGGG + Intronic
1041007854 8:53513150-53513172 TTGTAGTTTTAGGAGAGAGGGGG + Intergenic
1041158586 8:55013548-55013570 CTGATGCTTTAGGCAAGGGAAGG - Intergenic
1041989704 8:63971927-63971949 CTGCTGTTCTAGGAGAGGGAGGG - Intergenic
1042401854 8:68358868-68358890 TTGTAGTTTTAGGAGAGGCACGG + Intronic
1042511455 8:69616723-69616745 CTGTATTTTTAGTAGAGAGAGGG + Intronic
1042908049 8:73794728-73794750 TTGTATTTTTAGTAGAGGGAGGG - Intronic
1043226917 8:77745186-77745208 CTGTGGGCTTAGGAGAGGGAGGG + Intergenic
1043811612 8:84749647-84749669 ATGTAGCATTGGGAGAGGGAAGG + Intronic
1044635492 8:94319820-94319842 GTGCAGCTTAAGGAGAGGAAAGG - Intergenic
1045414353 8:101951770-101951792 CTGTAGCTTGAGGATCAGGATGG - Intronic
1045673428 8:104582928-104582950 CTGTAGGTTTTGGGGTGGGAAGG - Intronic
1046038127 8:108868620-108868642 CTTTAGCTTTTGGAGAGGTCTGG + Intergenic
1046710502 8:117505913-117505935 GAGTAGCTGTAGGAGATGGAGGG - Intergenic
1047011105 8:120673461-120673483 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1050344334 9:4671530-4671552 CTGTATTTTTAGTAGAGGCAGGG - Intergenic
1050600497 9:7245552-7245574 CTGTGGCTATAAGAAAGGGATGG + Intergenic
1050662150 9:7894399-7894421 CTGTACCTTGCAGAGAGGGAAGG - Intergenic
1050718191 9:8554012-8554034 TTGTATCTTTAGTAGAGAGAGGG - Intronic
1051287998 9:15515552-15515574 TTGTAGTTTTAGGAGAGATAGGG + Intergenic
1056587208 9:87936617-87936639 CTGTAGTTTTAGTAGAGACAGGG + Intergenic
1056609668 9:88116326-88116348 CTGTAGTTTTAGTAGAGACAGGG - Intergenic
1056745625 9:89299345-89299367 TTGTATCTTTAGTAGAGGCAGGG - Intergenic
1057594240 9:96401351-96401373 TTGTAGTTTTAGTAGAGGCAGGG - Intronic
1057801199 9:98192458-98192480 CTGCAGCTCCCGGAGAGGGAGGG - Intronic
1058075365 9:100645066-100645088 CTGAAGATGTAGGAGAGAGAAGG + Intergenic
1058228583 9:102397383-102397405 GGGTAACTTCAGGAGAGGGAAGG - Intergenic
1058902255 9:109452093-109452115 TTGTATCTTTAGGAGAGGTGGGG - Intronic
1058924688 9:109651303-109651325 CTGTAGCTGTAGCAGTAGGAAGG - Intronic
1060201566 9:121654581-121654603 CTGAGGCTTTAGTGGAGGGAGGG - Intronic
1060680849 9:125562906-125562928 CTGTGGCTTTGGCAGAGGAATGG - Intronic
1060799659 9:126535500-126535522 TTGTAGGTTTGGGAGAGGGTGGG - Intergenic
1061470017 9:130816874-130816896 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1061533770 9:131235040-131235062 CTGTGCAGTTAGGAGAGGGAGGG + Intergenic
1185470818 X:381770-381792 CTGTATCTTTAGTAGAGACAGGG + Intronic
1187380648 X:18798794-18798816 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1187491404 X:19755193-19755215 TTGTATCTTTAGTAGAGGCAGGG - Intronic
1187868564 X:23745537-23745559 TTGTATCTTTAGTAGAGGCAGGG - Intronic
1187912843 X:24126758-24126780 TTGTAGTTTTAGTAGAGGCAGGG + Intergenic
1189490401 X:41466974-41466996 TTGTAGTTTTAGTAGAGGCAGGG + Intronic
1190361120 X:49649382-49649404 CTGTAGTTTTAGTAGAGACAGGG + Intergenic
1192100689 X:68261322-68261344 CTCTAGCCTTATGACAGGGAGGG - Intronic
1192282114 X:69698373-69698395 TTGTAGCTTTTTGAGAGGGTTGG + Intronic
1192952531 X:76032350-76032372 CTGTATCTCTAGGAGAAGGGGGG - Intergenic
1193396126 X:80985665-80985687 GTGAAGCCTGAGGAGAGGGAGGG + Intergenic
1195704992 X:107732215-107732237 ATGTAGCCTTGGCAGAGGGAGGG - Intronic
1196365011 X:114914200-114914222 CTCTATCTTTAGCAGAGAGAAGG + Intergenic
1196477388 X:116104513-116104535 CTATTGCCTTAGGAAAGGGAAGG + Intergenic
1197077214 X:122366181-122366203 TTGTAGCTTTAGTAGAGACAGGG + Intergenic
1199319606 X:146422856-146422878 CTGGAGGTTCAGGAGAGGGAAGG - Intergenic
1199996178 X:153028190-153028212 CTGGAGCCTGAGGAGAGGGGAGG + Intergenic
1200987441 Y:9318115-9318137 TTGTATCTTTAGGAGAGACAGGG + Intergenic
1201059221 Y:10029510-10029532 TTGTACCTTTAGGAGAGACAGGG + Intergenic
1202118148 Y:21494558-21494580 TTGTATCTTTAGGAGAGACAGGG - Intergenic
1202120599 Y:21518098-21518120 TTGTATCTTTAGGAGAGACAGGG - Intronic
1202123050 Y:21541639-21541661 TTGTATCTTTAGGAGAGACAGGG - Intronic
1202155955 Y:21887742-21887764 TTGTATCTTTAGGAGAGACAGGG + Intronic
1202158403 Y:21911283-21911305 TTGTATCTTTAGGAGAGACAGGG + Intronic
1202184858 Y:22176208-22176230 TTGTATCTTTAGGAGAGACAGGG + Intronic
1202198011 Y:22315515-22315537 CTGTATTTTTAGGAGAGACAGGG - Intronic
1202206502 Y:22410193-22410215 TTGTATCTTTAGGAGAGACAGGG - Intronic