ID: 1092062597

View in Genome Browser
Species Human (GRCh38)
Location 12:5563612-5563634
Sequence GCCTGGGGAGGTGGCGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 885
Summary {0: 1, 1: 0, 2: 7, 3: 94, 4: 783}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092062585_1092062597 10 Left 1092062585 12:5563579-5563601 CCAAGGAGAGAGGGGCTGAGTTG 0: 1
1: 0
2: 6
3: 37
4: 379
Right 1092062597 12:5563612-5563634 GCCTGGGGAGGTGGCGGCCCTGG 0: 1
1: 0
2: 7
3: 94
4: 783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092062597 Original CRISPR GCCTGGGGAGGTGGCGGCCC TGG Intronic
900032604 1:381894-381916 GCCGGGGGAGGTGGCGGGCTGGG - Intergenic
900053362 1:610956-610978 GCCGGGGGAGGTGGCGGGCTGGG - Intergenic
900188262 1:1342924-1342946 TGCTGGGGGGGTGGGGGCCCAGG - Intronic
900188290 1:1343021-1343043 TGCTGGGGGGGTGGGGGCCCAGG - Intronic
900203624 1:1421868-1421890 GCCTGGGCAGGTGGGGGCGGGGG + Intergenic
900216377 1:1484034-1484056 GCCTGCTGTGGTGGCGCCCCAGG - Intronic
900242153 1:1622198-1622220 GCCAGGGAAGGAGGCAGCCCAGG - Intronic
900345403 1:2208124-2208146 GCCTGGGGGGGTGACTGCCAGGG + Intronic
900368291 1:2320375-2320397 CCCTGGGGAGGGGGCGTCCAGGG - Intergenic
900402493 1:2478266-2478288 ACCTGGGGTGGAGGTGGCCCTGG + Intronic
900502337 1:3012607-3012629 GCCTGGGGAGGCGGCGGGGTGGG - Intergenic
900609654 1:3539165-3539187 GCGTGGTGGGGAGGCGGCCCAGG + Intronic
900611616 1:3546784-3546806 GCCTGGGAAGGGGGCTGCCAGGG + Intronic
900690078 1:3975507-3975529 ACCTGGAGAGATGGCTGCCCTGG + Intergenic
900707340 1:4088948-4088970 GCCTGTGGTGGCGGCAGCCCCGG + Intergenic
900808114 1:4781208-4781230 GACTGGGGAGGAGGGGCCCCAGG - Intronic
900974882 1:6010772-6010794 TCCTGGGAAGGTAGTGGCCCGGG + Intronic
901018719 1:6245458-6245480 GCCTGCGCGTGTGGCGGCCCTGG + Exonic
901138058 1:7010282-7010304 GCCGAGTGAGGGGGCGGCCCAGG - Intronic
901209992 1:7519283-7519305 GCCAGGAGAGGTGGGGGCACAGG + Intronic
901232013 1:7646635-7646657 CCCTGGTGAGGTAGAGGCCCTGG + Intronic
901361333 1:8703298-8703320 GGCTAGGGAGGCGGCCGCCCTGG + Intronic
901414617 1:9108123-9108145 GCCTGGGATGCTGACGGCCCAGG + Intronic
901685304 1:10940465-10940487 GCCTGGGAAGGCGGTGGCCTAGG - Intergenic
901689983 1:10966516-10966538 GCCTGTGGAGGTGGCTTCTCTGG + Intronic
901810914 1:11766394-11766416 GTCTGGGGAGCTGGAGGTCCAGG + Exonic
901855116 1:12039507-12039529 GCCTCGGGAGCTGGAGGCCCAGG - Intergenic
902143814 1:14379619-14379641 GCCTGTGGGGGTGGTGGCCATGG + Intergenic
902301831 1:15507403-15507425 GCCTGGGGAGAGGGCAGCCTTGG - Intronic
902504370 1:16929869-16929891 GCCTGGGGAGCTGGAGACGCAGG + Exonic
902628268 1:17689327-17689349 GGCTGGGAAGGTGGCTGTCCTGG + Intronic
902755611 1:18547479-18547501 TGCTGGGGAGGTGGCGGACAGGG - Intergenic
903864938 1:26391077-26391099 GCCTTGGGAAATGGAGGCCCCGG + Intergenic
903956774 1:27031533-27031555 GTCTGGGGAGAGGGCGGCTCTGG - Intergenic
904261346 1:29289554-29289576 GGCTGGGGAGGGGGCTGGCCAGG - Intronic
904300547 1:29550799-29550821 GCTGGGGGAGGGGCCGGCCCCGG - Intergenic
904587940 1:31590360-31590382 GCCTGGTGTGGTGGCGGGCATGG - Intergenic
904591453 1:31617744-31617766 GCCTAGGGAGGGGGCTGCCCCGG + Exonic
904769267 1:32871776-32871798 GGCTGGGGAGGAGCTGGCCCCGG - Intronic
904813790 1:33180986-33181008 GCCTGGGGAAGGGGCGGGGCCGG - Intronic
905028986 1:34868909-34868931 GACTGAGTAGGTGGGGGCCCGGG + Exonic
905042553 1:34972515-34972537 GCCTGGGGAGCAGGTGGCACGGG + Intergenic
905314073 1:37069906-37069928 GCCTGGGGAAGTGGGGGCTGAGG + Intergenic
905364109 1:37439422-37439444 GCCTGTGGGGTTGGGGGCCCTGG - Intergenic
905765277 1:40595384-40595406 GCCCGGTCTGGTGGCGGCCCAGG - Intergenic
906127043 1:43433075-43433097 GGCTGTGGAGGTGCTGGCCCAGG - Exonic
906568775 1:46818858-46818880 GCCTGGGGAGGGTGGTGCCCAGG - Exonic
906607275 1:47181227-47181249 GCCTGGGGAGGGGGAGCCTCTGG - Intergenic
908175530 1:61552119-61552141 GCCTGGGGTGGTGGTGGCCATGG - Intergenic
908477805 1:64505979-64506001 GGATGTGGAGGTGGCGACCCGGG - Intronic
910450102 1:87335394-87335416 GCCTCGGGCGGCGCCGGCCCGGG - Intronic
911019906 1:93375667-93375689 GCCTGGGGCAGTGGTGGCCATGG + Intergenic
911981179 1:104568775-104568797 GCCTGGGGTAGTGGTGGCACAGG + Intergenic
912174707 1:107141294-107141316 GCCTGGGGAGGAGGCTCCGCGGG + Intronic
912710784 1:111948398-111948420 GCGTAGGGAGGCGGCAGCCCTGG + Intronic
914831949 1:151176696-151176718 GGCTCAGGAGGTGGCGGGCCGGG + Exonic
914887019 1:151593843-151593865 GTTTGGGGAGGGGGCGGGCCAGG + Intergenic
915170987 1:153977198-153977220 ACCAGCAGAGGTGGCGGCCCTGG + Exonic
915463034 1:156081144-156081166 GGCTGGGGAGGGGGCATCCCTGG - Intronic
919914968 1:202133653-202133675 GGCCGTGGAGGTGGGGGCCCTGG + Exonic
920528449 1:206685172-206685194 GCCGGAGGAGGGGGCGGCCGCGG + Exonic
920953604 1:210597599-210597621 GCCTGGGGTGGTGGTAGCCAAGG - Intronic
920968102 1:210717995-210718017 TACTGGGGAGGCGGAGGCCCGGG + Intronic
921317367 1:213905227-213905249 GCGTGGGAAGGTGGCAGCCATGG + Intergenic
921361343 1:214333395-214333417 TCCTGGGTAGGAGGCAGCCCTGG - Intronic
922044354 1:221928900-221928922 GCCTGAGGTGGTGGTGGCCTGGG + Intergenic
922250657 1:223846028-223846050 GCCTGGGGGAGGGGCGGCCGCGG + Intergenic
922377191 1:224980360-224980382 GCCTGTGGTGGTGGTGGCCACGG + Intronic
922513149 1:226186477-226186499 GCCCGGGGAGGCGGCGGCTGGGG - Exonic
922516422 1:226211419-226211441 GCCTGGCCAGGTGGAGGCCATGG + Intergenic
922722326 1:227905345-227905367 GCCTGGGGTGGGGGTGGGCCAGG - Intergenic
922796822 1:228343593-228343615 GGCCAGGGAGGTGGGGGCCCAGG + Intronic
922851314 1:228735838-228735860 GCCTGGGGAGCCGGGGGGCCGGG + Exonic
922886208 1:229022846-229022868 GCATGGGGAGGAGGCGGGCCAGG + Intergenic
923491819 1:234490944-234490966 GCCTGGGTAGGTGCTGGCACAGG - Intergenic
923744306 1:236686412-236686434 GCCGGGGGCGGTGGCGGCGGGGG + Intergenic
924803937 1:247347907-247347929 GGATGGGGAGGTGGGGGCCGGGG - Intergenic
1062949154 10:1484389-1484411 GCCTGGGGTGGCAGCGGCACAGG - Intronic
1062951261 10:1505649-1505671 GCATGGGGAGGTGGCTGCCATGG - Intronic
1062951276 10:1505698-1505720 GCATGGGGAGGCGGCTGCCACGG - Intronic
1062951292 10:1505747-1505769 GCATGGGGAGGCGGCTGCCATGG - Intronic
1063130342 10:3172600-3172622 GCTTGGGGAGCTGCCAGCCCCGG + Intronic
1063367014 10:5496979-5497001 CTTTGGGGAGGTGGCGGCCCTGG - Intergenic
1063482522 10:6388422-6388444 TCCTGGGGACATGGCAGCCCTGG - Intergenic
1063623365 10:7667639-7667661 GACTGGGGAGGAGGCGGGGCTGG - Intergenic
1063904279 10:10766551-10766573 GCCAGGGGAGGTGTCAGCCTCGG + Intergenic
1064141618 10:12795467-12795489 GTGTGGGGAGGTGGCCTCCCTGG - Intronic
1064791121 10:18958938-18958960 GCCTGGTGAGGTGTGGGCCAGGG + Intergenic
1064987463 10:21225651-21225673 ACCTGGGGAGGTGGTGGCCATGG - Intergenic
1065025035 10:21533916-21533938 GGCGGGGGAGGTGGACGCCCAGG - Intergenic
1065252689 10:23832564-23832586 GGATGGGGAGGTGGCTGCCAGGG - Intronic
1065358259 10:24863940-24863962 GCCTGGGGAGGTAGAGGCTGTGG + Intronic
1065483450 10:26216036-26216058 GCCTGGGGAGGGGACGGCGGGGG - Intergenic
1065486039 10:26237335-26237357 GCCTTGGGAGGTGGCAGAGCAGG - Intronic
1066561942 10:36679336-36679358 GCCTGGGGAGGAGGTGGGCCAGG - Intergenic
1067077205 10:43194947-43194969 GCCTGGGGAGGAGGCAGCCCTGG - Exonic
1067083745 10:43227554-43227576 GCCTGGGAAGGCTGGGGCCCAGG + Intronic
1067549434 10:47223464-47223486 GCCCTGGGAGATGGCAGCCCTGG - Intergenic
1068103899 10:52590724-52590746 GCCTGTGGTGGTGGTGGCCAAGG - Intergenic
1068860650 10:61844706-61844728 GCCTGGGGTGGCGGCTTCCCTGG - Intergenic
1068910461 10:62374195-62374217 CCCCGCGGAGGTGGCAGCCCTGG + Exonic
1069604697 10:69731917-69731939 GCCTGTGGAGGGGGCGGGCCAGG - Intergenic
1069875819 10:71562286-71562308 GCATGGGGAGGTGGCCGGACGGG - Intronic
1069933527 10:71899838-71899860 GCCTGTGGTGGTGGTGGCCACGG - Intergenic
1069959600 10:72072114-72072136 GTTTGGGGAGGTGGGAGCCCTGG - Intronic
1070079088 10:73168154-73168176 GACTGGAGAGGTGGGGACCCTGG + Exonic
1070149449 10:73797010-73797032 GCCTGGTGAGGTGGGGGCACTGG + Exonic
1070587766 10:77779764-77779786 CCCTGGGGAGGAAGCTGCCCTGG - Intergenic
1070802030 10:79249420-79249442 GCATGAGGACATGGCGGCCCTGG + Intronic
1071041128 10:81309422-81309444 GCCTGCGGTGCTGGCGGGCCAGG - Intergenic
1071418530 10:85464291-85464313 GCCTGTGGTGGTGGTGGCCATGG + Intergenic
1071514898 10:86290933-86290955 TCCTGGAGAGGAAGCGGCCCAGG + Intronic
1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG + Intergenic
1071630442 10:87214824-87214846 CCCTGGGCTGGTGGCAGCCCTGG + Intergenic
1071767861 10:88689355-88689377 GCCTGGGGTGGTGGTGGCCATGG + Intergenic
1072248862 10:93566484-93566506 GGCCGGGGAGGTGGCGGCCAAGG - Intergenic
1072926482 10:99620983-99621005 GGCTGGAGAGCGGGCGGCCCTGG + Intergenic
1073095816 10:100979081-100979103 CCCTGGGGAGGTAGAGGCACGGG - Exonic
1074032978 10:109707576-109707598 GCCTGGGGAGGTCGAGGCTGTGG - Intergenic
1074552742 10:114460153-114460175 TCCTGGGGAGGAGGGGGCCTGGG + Intronic
1075461630 10:122620411-122620433 GCCTGGGGAGGTAGACTCCCTGG + Intronic
1075639395 10:124053839-124053861 GCCTGGGGAGGTTGAGGCTACGG + Intronic
1075673255 10:124278607-124278629 GCCTGGGGAAATGGAGGCCCTGG - Intergenic
1075733453 10:124649950-124649972 GCCTGGGCAAGTGACTGCCCTGG - Intronic
1075791024 10:125084550-125084572 GGCTGGGGAGGTGGCTTCCAGGG - Intronic
1075915398 10:126162219-126162241 GCCTGGGGAGGGGGTGCCCAAGG + Intronic
1076340999 10:129744739-129744761 GGCTGGCGATGTGGCGGGCCAGG - Intronic
1076556213 10:131322933-131322955 GCCAGGGCAGGAGGCTGCCCGGG + Intergenic
1076638922 10:131901046-131901068 GCCGGCGGTGGTGGCGGCCCCGG + Exonic
1076814906 10:132909833-132909855 GCCGGGGGTGGTGGGGCCCCCGG - Intronic
1076821830 10:132943372-132943394 GCCTGGGGAGGGGAGGGCCCGGG + Intergenic
1076829640 10:132987858-132987880 GCCTGGAGAGGCAGTGGCCCTGG + Intergenic
1076830630 10:132992564-132992586 GGCTGAGGGGGTGGCAGCCCTGG - Intergenic
1077159904 11:1107939-1107961 GTCTGGCCAGGTGGCCGCCCCGG + Intergenic
1077179036 11:1204047-1204069 GCCAGGGGCTGTGGCGACCCAGG - Intergenic
1077185394 11:1233446-1233468 GCCAGGAGAGGAGGTGGCCCTGG + Intronic
1077223491 11:1427508-1427530 GCCTGGGCATGTGGAGCCCCAGG - Intronic
1077225232 11:1436637-1436659 CAGTGGGGAGGGGGCGGCCCCGG + Intronic
1077233383 11:1468585-1468607 TCGTGGGGAGGTGGCGGACCAGG + Intergenic
1077244148 11:1527890-1527912 GCCGGGGGAGCTGGGGGCCAGGG - Intergenic
1077264578 11:1642416-1642438 GCCAGTGGAGGGGGCGGGCCAGG - Intergenic
1077301050 11:1847145-1847167 GCCAGGGGAGGGAGAGGCCCTGG - Intergenic
1077330298 11:1981229-1981251 GCCTGGGCCGGTGGGGGCACAGG - Intronic
1077436167 11:2540195-2540217 GCCTGGGGAGGGGGCTGGGCAGG + Intronic
1077499146 11:2901466-2901488 GCCTGGGGAGGAGGTGGGGCAGG + Intronic
1077501919 11:2913181-2913203 GGCTGGGGGGGCGGCGGGCCTGG - Intronic
1078063384 11:8062241-8062263 GCCTGGGCAGGTGGGGGCCGCGG + Intronic
1078106640 11:8361950-8361972 TCCTGGGGAGGTGTCTGACCAGG - Intergenic
1078245915 11:9573444-9573466 GCCTGGGGCGGCGGGGGGCCCGG - Intergenic
1079088313 11:17462970-17462992 GCCTGGGGAGGTAGGGGCAGGGG + Intronic
1079571915 11:21953399-21953421 GCCTGTGGAAGTGGTGGCCATGG + Intergenic
1080893210 11:36427386-36427408 GCCTGGGGAGGTGGTGGGGTTGG + Intronic
1081488210 11:43547773-43547795 GACTGGGGAGGGGGCTTCCCCGG + Intergenic
1081606593 11:44531058-44531080 GGCTGGGCAGGAGGTGGCCCAGG - Intergenic
1081620921 11:44618792-44618814 CCTTGGGGAGGTGGTGGCCAAGG + Intronic
1081699701 11:45145482-45145504 GCCTTGGGAGGAGGCTTCCCTGG + Intronic
1082045260 11:47720831-47720853 GCCGGGGGCGGTGGCGGCGGCGG + Intronic
1083004318 11:59327437-59327459 GGCTGGGGAGGTGGTGGGCAGGG - Intergenic
1083595190 11:63915675-63915697 GGCGGGGGAGGTGGCCGGCCTGG + Intronic
1083610082 11:64000373-64000395 GCCTGGCAAGGCTGCGGCCCCGG + Intronic
1083737834 11:64691783-64691805 GTCTGGGGAGGTAGAGGCCTTGG - Intronic
1083753756 11:64778238-64778260 GGCGGGGGCGGCGGCGGCCCGGG + Exonic
1083764469 11:64835418-64835440 GCCTGGGGAGGAGAAGGCCAAGG + Exonic
1083793600 11:65001821-65001843 GGCTGGGGATGTGCCTGCCCTGG - Intergenic
1083869229 11:65477004-65477026 GCCTGGGCAGGTGGCTGCCTTGG + Intergenic
1084091793 11:66883473-66883495 GCTGAGGGAGGTGGCTGCCCGGG - Intronic
1084758261 11:71252407-71252429 GCCAGGTGAGGCGGCGGCCGGGG - Intronic
1085024700 11:73229631-73229653 GCCTGGGAGGGTGGGGGCCAGGG + Intronic
1085515059 11:77106970-77106992 TGCTGGGGAGCTGGAGGCCCGGG + Intronic
1085734702 11:79029406-79029428 GGGTGGGGAGGTGGCAGTCCTGG - Intronic
1085755526 11:79198382-79198404 GCCTGGGGAGGCGCCAGGCCTGG + Intronic
1086120946 11:83304063-83304085 GCCTGGGGAGATGGTGGTCTTGG + Intergenic
1086569665 11:88267092-88267114 GCCTGGGGCAGTGGTGGCCATGG + Intergenic
1087201370 11:95347461-95347483 GCCTGGGGTGGTGGTGGCTATGG + Intergenic
1087528629 11:99351012-99351034 GCCTGTGGGGGTGGGGGCCTAGG + Intronic
1087950772 11:104218502-104218524 GCCTGTGGGGGTGTTGGCCCAGG - Intergenic
1088764387 11:112962018-112962040 GGCGGGGGAGGTCGCGGCTCGGG + Intronic
1088988478 11:114929778-114929800 CCCTGGGGAGGAGACTGCCCTGG + Intergenic
1089266771 11:117269437-117269459 GCCTGGGGAGGTCGAGGCTGTGG - Intronic
1089479116 11:118791062-118791084 GCCGGGGGAGCCGGCGGCTCGGG - Intronic
1089602666 11:119625014-119625036 GCTGGGGGAGGGGGAGGCCCTGG + Intronic
1089617336 11:119702256-119702278 GCCGAGGGAGGTGGAGGCCCTGG - Intronic
1089698405 11:120229514-120229536 GTCTGGGGAGGTGGGTGTCCAGG - Exonic
1089733957 11:120536919-120536941 GCCTGCTGAGGAGGCGGCCAGGG + Intronic
1089937136 11:122375844-122375866 GCCTGTGGTGGTGGTGGCCATGG + Intergenic
1090331049 11:125932499-125932521 GGCAGGGGAGCTGGGGGCCCAGG + Intergenic
1202813277 11_KI270721v1_random:36408-36430 GCCTGGGCCGGTGGGGGCACAGG - Intergenic
1091403717 12:196319-196341 GCCAGGGGAAGTGGAGGCCAGGG - Intronic
1091669037 12:2439202-2439224 CCCTGGGCAGGTGGCTGGCCTGG + Intronic
1091696949 12:2634007-2634029 GCGTGGGGCTGTGGCCGCCCCGG - Intronic
1091792768 12:3281119-3281141 GCCTGGGCAGGGGAAGGCCCTGG + Intronic
1092062597 12:5563612-5563634 GCCTGGGGAGGTGGCGGCCCTGG + Intronic
1092230341 12:6772606-6772628 GCCTGAGGAGGTGGGGGCGGGGG - Exonic
1093931854 12:24961697-24961719 GCCTGGGGTGGTGGTGGTCATGG + Intergenic
1094004911 12:25738912-25738934 GCCTGGAGAGGAGGCTGCACTGG + Intergenic
1094192373 12:27710742-27710764 GCCTAGGGCGGTGCCAGCCCAGG + Intergenic
1094818201 12:34206153-34206175 GCCTGGGGAAGGGGCGGGCAGGG + Intergenic
1095099136 12:38163077-38163099 GCCAGGGGAAGTGGCGGCCAGGG - Intergenic
1096071998 12:48780601-48780623 GACTGGGGAGGTGCAGTCCCAGG - Intronic
1096259369 12:50081398-50081420 TCCTGGGGCGGTGGAGGCACAGG - Intronic
1096496479 12:52042041-52042063 CCCTGGGGAGGTGGCAGCCGAGG + Intronic
1096505278 12:52088638-52088660 GCAAGGCGAGGTGGCGGCCGGGG - Intergenic
1096814132 12:54191095-54191117 GGGTGGGGAGGTGGAGGTCCTGG - Intergenic
1097017012 12:55994355-55994377 GCCTGGGGAAGTGGTTTCCCAGG - Exonic
1097173050 12:57128216-57128238 GCCAGGGGAGAGGGCGCCCCAGG + Intronic
1097240242 12:57570015-57570037 GGCTGGGGAGGAGGCAGCCCTGG + Exonic
1099024553 12:77448597-77448619 GCCTGGGGTGGTGGTGGCCATGG + Intergenic
1099055439 12:77834094-77834116 GAATGGGGAGGTGGTGGGCCAGG + Intronic
1101493843 12:105235790-105235812 GGCTGAGGAGGGGGCGGGCCGGG - Intronic
1101679860 12:106955143-106955165 GCCTAGGGTGATGGCGACCCAGG + Intergenic
1102057998 12:109911113-109911135 GCCTGGCCAGGTGGAGGCGCTGG - Exonic
1102151021 12:110689180-110689202 GACGGGGGCGGGGGCGGCCCGGG - Intronic
1102244718 12:111348057-111348079 GCCTGGTGAGGAGGCGGCCGAGG - Exonic
1102253849 12:111405321-111405343 GCCTGGGGCCGTGGCGGGTCGGG + Intergenic
1103232661 12:119344955-119344977 GGATGGGGAGGTGGTGGCCAGGG - Intronic
1103364015 12:120369339-120369361 GCCCGCGGAGGCGGCGGCGCCGG + Intergenic
1103817696 12:123671676-123671698 GCCTGGAGAGGTGGCATCCTTGG + Intronic
1104247834 12:127060555-127060577 GGCTGGGGGCGTGGCGGGCCAGG - Intergenic
1104900873 12:132188999-132189021 AGCTGGGGAGGTGGCGGAGCCGG - Intergenic
1104963276 12:132498125-132498147 GCCTGGGGAGGTGGCTGGCAGGG + Intronic
1105011956 12:132761955-132761977 GCCCGGCGAGGGCGCGGCCCCGG + Intergenic
1105964527 13:25372322-25372344 GCCCGGGGCGGGGGCGGCGCGGG + Intronic
1106099596 13:26682815-26682837 GGCGGGGGAGGTGGTGGGCCCGG - Exonic
1107146872 13:37069689-37069711 GCGTGGGGAGGAGGCGGAGCTGG + Intergenic
1108408003 13:50124289-50124311 GCGTCGGGAGGGGGCGGCCGCGG + Intronic
1108408309 13:50125443-50125465 GCCGGGGGAGGGGGCGGGCGCGG - Intronic
1109685883 13:65819152-65819174 GCCTGTGGTGGTGGTGGCCACGG + Intergenic
1109747698 13:66647932-66647954 GCCTGGGGAAGAGACGGCCAGGG + Intronic
1110705955 13:78602214-78602236 CCGGGGGGCGGTGGCGGCCCGGG - Exonic
1112050666 13:95641908-95641930 GGCTGGGGAGCTGGGGGTCCGGG + Intronic
1112050713 13:95642069-95642091 GGCTGTGGCGGCGGCGGCCCGGG - Exonic
1112505032 13:99970402-99970424 GCCGGGGGCGGTGGCGGCGGCGG + Exonic
1113083021 13:106536353-106536375 CCCCGGGAAGGTGGCGCCCCTGG + Intergenic
1115687242 14:35808996-35809018 GCGGGTGGAGGTGGCGGCCCTGG - Exonic
1116865052 14:50025130-50025152 GCCTGGGGAGAGGGCGCTCCTGG - Intergenic
1118728839 14:68652420-68652442 GGCTGGGGAGGGGGCCGTCCAGG - Intronic
1118776811 14:68978710-68978732 GCGCGGGGAGGTGGCGCCGCTGG - Intronic
1119260437 14:73235182-73235204 GCCTGGGGCGGAGGCAGACCTGG - Intergenic
1119519705 14:75277117-75277139 GGCCGGGGAGGCCGCGGCCCAGG + Intergenic
1119539302 14:75428218-75428240 GCGGGGGGAGGCGGCGCCCCCGG - Intronic
1120100171 14:80435502-80435524 ACCTGGGGTGGTGGTGGCCATGG + Intergenic
1121001083 14:90452530-90452552 GCCTGGGCAGGGGAGGGCCCTGG + Intergenic
1121153009 14:91654483-91654505 GCTTGGGGTGGTGGTGGCCATGG + Intronic
1121441772 14:93954117-93954139 GCCTGGAGAGGTGGCAGCAGGGG + Intronic
1122127334 14:99586416-99586438 GCCTGGGGAGGTGGAGGTTTTGG - Intronic
1122400611 14:101465225-101465247 GCATGGGGACATGGGGGCCCAGG - Intergenic
1122558005 14:102591979-102592001 GCCAGGGGAGGCGGCCGCCTGGG + Intergenic
1122639609 14:103150864-103150886 GCCTGGGGTGGTGGTGGCAGGGG - Intergenic
1122788281 14:104173880-104173902 GCCTGGGCAGGTGCCGACCAGGG + Intronic
1122823452 14:104358607-104358629 GCATGAGGAGGTGGGGGCACAGG + Intergenic
1123041310 14:105491374-105491396 GCATGGGGAGGCGGCGGCAGCGG + Exonic
1123932528 15:25178712-25178734 GCATGGGGAGGAGGGTGCCCTGG + Intergenic
1123942271 15:25222321-25222343 GCATGGGGAGGGGGGTGCCCTGG + Intergenic
1124517199 15:30376700-30376722 GCCTGGAGAGGTGGCTTGCCAGG + Intronic
1124629381 15:31328016-31328038 GCCCGGGGAGGGGGCGTGCCCGG - Intronic
1124725745 15:32154294-32154316 GCCTGGAGAGGTGGCTTGCCAGG - Intronic
1125003599 15:34795417-34795439 GGCTGGCCAGGTGGCGGCGCGGG + Intronic
1125608553 15:40956100-40956122 CCCTGGGGAGGTGGAGGCCTGGG - Exonic
1125828269 15:42693674-42693696 GCCTGAGAAGGTGGCTTCCCCGG + Exonic
1125957516 15:43800533-43800555 GCCCGGGGAGGAGGCGGGGCTGG - Exonic
1126111817 15:45179676-45179698 TCCTGGGGTGCTGGCAGCCCTGG - Intronic
1126134606 15:45378279-45378301 GCGAGGGAAGGTGGCGGCTCCGG + Intronic
1127783395 15:62335470-62335492 GCCTGGGGTGGTGGTGGCCATGG - Intergenic
1127971479 15:63965721-63965743 GCCTGGGGCAGTGGGGGCCATGG - Intronic
1128138069 15:65278631-65278653 TCCTGGGGAGGAGGTGGCCCAGG + Intronic
1128160641 15:65421406-65421428 GCCAGAGGAGCTGGAGGCCCTGG - Intronic
1128301704 15:66570147-66570169 GGCTGCAGAGGTGGGGGCCCAGG + Intergenic
1128453383 15:67819926-67819948 GCCCGGCGCGGCGGCGGCCCTGG - Intronic
1128594405 15:68930729-68930751 GCCTGAGGAGGCAGCGGACCGGG + Intronic
1128737863 15:70063480-70063502 GCCTGGGTAGGGGGAGGGCCAGG + Intronic
1128901007 15:71422956-71422978 GCCTGTGGAGGTGGTGGCCACGG - Intronic
1129194833 15:73957581-73957603 GGCTGGGGAGGTGGTGGCTATGG - Intergenic
1129467267 15:75731122-75731144 ACCTGGGGGGATGGTGGCCCTGG + Intergenic
1129540292 15:76342676-76342698 CCCTGGGCACCTGGCGGCCCAGG + Intergenic
1129719959 15:77872595-77872617 ACCTGGGGGGATGGTGGCCCTGG - Intergenic
1129728331 15:77915424-77915446 TCCTGGGGGGCTGGGGGCCCTGG + Intergenic
1130531238 15:84748847-84748869 GCGGGGTGGGGTGGCGGCCCGGG - Intronic
1130580788 15:85135334-85135356 GCCTGAGGAGGTGTTGGGCCAGG - Intronic
1130633718 15:85596504-85596526 GCCTGGGGAGGTGGAGGCTGCGG + Intronic
1130967105 15:88705593-88705615 GCCTGCGGAGGGGGCGGCGTGGG - Intergenic
1131148837 15:90034483-90034505 GCCTGTGGTGGTGGTGGCCATGG + Intronic
1131367816 15:91854240-91854262 GCCGGGGGAGCTGCCGGCCGGGG + Intronic
1131707399 15:95012935-95012957 GCCTGGGGAGGTTGAGGCTGCGG + Intergenic
1131870233 15:96756730-96756752 GACTGGAGAGGTGGGGACCCTGG + Intergenic
1132117935 15:99151230-99151252 GCCTGGGGTGGAGGTGGCACAGG - Intronic
1132463784 16:68338-68360 GCGTGGGGAGGGGCAGGCCCAGG + Intronic
1132594518 16:742337-742359 CCCTGGGGAGGGTGCGGCGCAGG - Intronic
1132596242 16:751782-751804 GCCAGGGAAGGTGGCTGCCAGGG - Intronic
1132669455 16:1096667-1096689 GCCTGGGGAGGCTGCGCTCCTGG - Intergenic
1132700567 16:1220424-1220446 GCCTGGGGAGGCGAAGGCCTGGG + Exonic
1132829655 16:1921096-1921118 GCCTGAGGAGGAGGCGGGGCTGG - Intergenic
1132884149 16:2175170-2175192 GGGTGGGCAGGAGGCGGCCCAGG + Intronic
1132889502 16:2196794-2196816 ACGTGGGGAGGGGGCGTCCCGGG - Intergenic
1132900943 16:2253993-2254015 TCCTGTGGCGGCGGCGGCCCGGG + Exonic
1132995602 16:2820866-2820888 GGCTGCGGGGGTGGGGGCCCTGG - Intronic
1133017333 16:2950145-2950167 GCCTGGGCAAGTGGCACCCCTGG + Exonic
1133246914 16:4455171-4455193 TCCTGGGGAGGTGGCGATGCTGG + Intronic
1133248017 16:4462000-4462022 GCCCCGGGAGGTGGCGGGGCAGG + Intronic
1133258876 16:4535782-4535804 GCATGGGGAGGTTCTGGCCCAGG + Intronic
1133834122 16:9351302-9351324 GCCTGGGGCAGTGGTGGCCAAGG - Intergenic
1133977202 16:10607726-10607748 CCCTGGGGAGTTGGAGACCCTGG - Intergenic
1134336477 16:13304334-13304356 GCCTGGGGAGATTGAGGCCACGG - Intergenic
1134406980 16:13969562-13969584 GCCTGGGGTGGTGGTGGCCATGG - Intergenic
1135016203 16:18926561-18926583 GCCTGGGGACGTGGGGGGCGGGG - Intergenic
1135040541 16:19114218-19114240 GCCGGGGCAGGGCGCGGCCCGGG + Intronic
1135619890 16:23946749-23946771 GTCTGGGGAGGGGCCGGGCCTGG + Intronic
1136479813 16:30534363-30534385 GCGTGTGGAGTTGGGGGCCCCGG - Intronic
1137566991 16:49539506-49539528 GCCCGGGGAGGTGGGGTTCCAGG - Intronic
1138354183 16:56364660-56364682 GCCTGGGGAGGTTGAGGCTGTGG - Intronic
1138555165 16:57766620-57766642 GCCTGGGCAGGTGACTCCCCAGG - Intronic
1138608691 16:58105891-58105913 TCCTGGGGTGGTGGTGGCCTTGG + Intergenic
1139466138 16:67155122-67155144 GTCTGGGCAGGTGGCGGCGGCGG + Exonic
1139480404 16:67227364-67227386 GGCTGGGGGGATGGCGGCGCAGG + Intronic
1139546667 16:67652960-67652982 GCCCGGGGAGGTGGCGGCGGAGG - Intronic
1139750625 16:69107092-69107114 GCATGAGGAGGCGGCGGTCCAGG + Intronic
1140279561 16:73542269-73542291 GCCTGGGGCGGGGGCTGCACAGG + Intergenic
1140404613 16:74700530-74700552 GCCTGGGCAGGAGGCGGTCGTGG - Exonic
1140477416 16:75245779-75245801 GCCCGGAGAGGCGGGGGCCCTGG - Intronic
1141054554 16:80803824-80803846 GGCGGGGGAGGTAGCGGTCCCGG - Intronic
1141440808 16:84028668-84028690 GGCAGGGGAGGTGGCGGGCCTGG - Intronic
1141516286 16:84547493-84547515 GCCTGAGGAGGTGGAGGAGCTGG - Intronic
1141766862 16:86064563-86064585 GCCTGGGGAAGTCTCGGCTCTGG - Intergenic
1142136839 16:88455443-88455465 CCATGGGGAGGAGGCGCCCCGGG - Intronic
1142358151 16:89613764-89613786 ACCTGGGGTGGTGCAGGCCCGGG + Intronic
1142559745 17:802951-802973 GGGTGGGGAGGTGGCAGCGCAGG + Intronic
1142900565 17:3008845-3008867 GCCTGTGCAGGTGGCGGAACGGG + Intronic
1143303728 17:5929718-5929740 GCCTTGGGAGGTGAGGGCACAGG + Intronic
1143413751 17:6729465-6729487 GCCTGTGGTGGTGGTGGCCATGG + Intergenic
1143590758 17:7884983-7885005 GGCTGTGGCGGTCGCGGCCCCGG - Exonic
1143628909 17:8126034-8126056 GCCTGCGGAGGTGCGGGCCGGGG - Intergenic
1143670565 17:8393117-8393139 GGCAGGGGAGGAGGCGGCCAGGG + Exonic
1144547848 17:16214988-16215010 GCCGGCGCAGGTGGCGGGCCTGG - Intronic
1144626352 17:16846200-16846222 GGCTGGGGTGGTGGCTGCCTGGG - Intergenic
1144739172 17:17571655-17571677 TCCTGGGGAGCTGGGGGCACTGG - Intronic
1144880080 17:18426519-18426541 GGCTGGGGTGGTGGCTGCCTGGG + Intergenic
1145152153 17:20517865-20517887 GGCTGGGGTGGTGGCTGCCTGGG - Intergenic
1145397513 17:22506989-22507011 GCCGGGGGAAGTGGGGACCCAGG + Intergenic
1145909171 17:28532821-28532843 GGCTGGGGTGGGGGCTGCCCTGG + Intronic
1146063343 17:29618296-29618318 CCCTGGGAGGGCGGCGGCCCTGG - Intronic
1146163511 17:30572083-30572105 GGCTGGGGTGGTGGCTGCCTGGG - Intergenic
1146242490 17:31243580-31243602 GCCTGGGGCGATGGCGGCCATGG - Intronic
1147580498 17:41624898-41624920 GGCTGGGGTGGTGGCTGCCTGGG - Intergenic
1148052496 17:44776014-44776036 CCCTGGGGAGCTGGAGGGCCCGG + Intronic
1148084953 17:44988226-44988248 GCCTGGGATGGGGGCTGCCCTGG - Intergenic
1148568295 17:48646685-48646707 GGCGGGGGATGTGGCGGCTCTGG + Intergenic
1148617883 17:49014044-49014066 GGCTGGGGAGGGGGCGACCGTGG + Intronic
1148713036 17:49695639-49695661 GCCCGGGGAGGTGCAAGCCCAGG - Intergenic
1148804918 17:50259205-50259227 GACTGGGGAGGTGGAGGCAGCGG - Intergenic
1148913400 17:50955266-50955288 GCCTGGGGAGTTTGATGCCCAGG - Intergenic
1148945597 17:51259894-51259916 GCCCGGGGAGGGGGCGCCGCGGG - Exonic
1149296081 17:55264027-55264049 GCCTGGGGTGGTGCGGGCGCTGG - Intergenic
1149712530 17:58756192-58756214 ACCCGGGGAGGAGGCGGCCACGG + Exonic
1149991340 17:61385221-61385243 ACCTGGAGAGGTGGTGGCCCAGG - Intronic
1150121734 17:62609157-62609179 GCCTGGGGAGGTCGAGGCTGTGG - Intronic
1150211975 17:63446555-63446577 GCCTGCGGGGGTGGAGGGCCGGG + Intergenic
1150218069 17:63481206-63481228 GCCTGGGGTGGTGGGGGTCGGGG + Intergenic
1150286044 17:63954687-63954709 GCCTGGGGAGGTGGTGGGAGGGG + Intronic
1150562205 17:66303291-66303313 GCCCGGGGAGGTGAGGGGCCCGG - Intronic
1151368210 17:73630694-73630716 TCCCGGGGAGGTGGCAGGCCTGG + Intronic
1151408173 17:73902758-73902780 GCCTGGGGATGTGGCGCCCTGGG - Intergenic
1151699978 17:75737771-75737793 CCCTGGGGAGGTGGGGACCCAGG - Intronic
1151700016 17:75737860-75737882 CCCTGGTGAGGTGGGGACCCAGG - Intronic
1151911449 17:77086136-77086158 GTCTGGGGAGGTGGGGGCAAAGG + Intergenic
1151938874 17:77280960-77280982 GCCGGGCGAGGCGGCGGCGCCGG - Intronic
1152293044 17:79451651-79451673 CCCTGGTGAGGAGGCAGCCCAGG + Intronic
1152548882 17:81019465-81019487 GCGTGGGGAGGTGGGGGCAGAGG + Intergenic
1152552394 17:81036096-81036118 GACTGGGGAGGGGGCGGCAGGGG - Intronic
1152626202 17:81388931-81388953 GCCTGGGGAAGTCTGGGCCCGGG + Intergenic
1152654766 17:81514503-81514525 GTGCGGGGAGGTGCCGGCCCCGG + Intronic
1152659691 17:81536546-81536568 GCCGGGCGGGGTGGGGGCCCTGG - Exonic
1152784600 17:82241250-82241272 GCCGGGGGAGGTGGCGGGGGAGG + Intronic
1152947337 17:83205288-83205310 GCCGGGGGAGGTGGCGGGCTGGG + Intergenic
1153052932 18:917334-917356 GCCTGGGGAAATGGCGGGCAGGG - Intergenic
1153331468 18:3879469-3879491 GCCCGGGGAGGTGCTGGGCCGGG + Exonic
1154390485 18:13932377-13932399 TCCTGGGGAGGTGGGGGTCGGGG + Intergenic
1156008598 18:32471022-32471044 GCCGCGGGCGCTGGCGGCCCCGG - Intergenic
1156099607 18:33578321-33578343 GCCAGGGGCGGGGGCGGCGCCGG - Intergenic
1157621219 18:49018450-49018472 AGCTGGGGACATGGCGGCCCTGG - Intergenic
1157937020 18:51884260-51884282 GCCTGTGGTGCTGGTGGCCCTGG + Intergenic
1159511253 18:69400831-69400853 GCGGGGGGAGGGGGCGGGCCGGG - Intergenic
1160025098 18:75209760-75209782 GCCTGGGGAGCGGGAGGCACTGG - Intergenic
1160255335 18:77243581-77243603 GCCTGGGGACCTGGCTGCTCCGG - Intergenic
1160374793 18:78403537-78403559 GCCTGTGGAGGAGCAGGCCCGGG - Intergenic
1160499662 18:79395640-79395662 GCCCGGGGAGGGGGGCGCCCGGG - Intergenic
1160739415 19:679148-679170 GCCTGGGCATGAGACGGCCCAGG + Intronic
1160812841 19:1020420-1020442 GCCTGGGTAGGTGGGGACCTGGG + Intronic
1160895901 19:1401663-1401685 CCTTGGGGAGGGGGCGGCCGGGG - Intergenic
1160906989 19:1456178-1456200 ACCAGGGGTGGTGTCGGCCCAGG + Intronic
1160967908 19:1754557-1754579 CACGGGGGAGGCGGCGGCCCCGG + Exonic
1161006332 19:1938872-1938894 GCCTGGGGAGGTAGAGGCTGCGG + Intergenic
1161006666 19:1940722-1940744 GCGTGGGGCGGTGGCGGGCGCGG - Intergenic
1161065005 19:2233199-2233221 ACCTGGGGAAGTGGTTGCCCTGG - Exonic
1161075273 19:2282272-2282294 GGCAGGGGAGGCGGCGGCCTCGG - Intronic
1161210442 19:3062652-3062674 GCCCGGGGCGGGGGCGGGCCGGG - Intronic
1161323784 19:3653272-3653294 GCCTGGTGAGGGCTCGGCCCCGG - Exonic
1161338871 19:3729942-3729964 CCCTGGGGAGGGGGTGCCCCTGG - Intronic
1161421755 19:4179768-4179790 CCCCGTGGAGGTGGGGGCCCTGG + Intronic
1161611589 19:5246044-5246066 GACTGGGGAGGGGGCGGCAGTGG + Exonic
1161738364 19:6005532-6005554 GCCTCAGGAGCTGGAGGCCCTGG + Intronic
1161744608 19:6048053-6048075 GCTTGGGGAGGGGGCGCTCCTGG - Intronic
1162001437 19:7747006-7747028 TCCTGGAGAGGTGGGGGCCTGGG - Intronic
1162315602 19:9936468-9936490 GGCGGGGGAGGCGGCGGCGCAGG - Exonic
1162318985 19:9959811-9959833 GCCTGGGGAGGTGGGGGGCAGGG + Exonic
1162469304 19:10862873-10862895 GCCTGGGGAGGAGGAGGAGCTGG + Intronic
1162830573 19:13281998-13282020 GCGTGGGGAGGAGGTGTCCCTGG - Intronic
1162932089 19:13962406-13962428 GCCTGGGAGGGGGGCGGCCAAGG + Exonic
1162967894 19:14164582-14164604 GCCAGGGGAGGTGGGGGGCCTGG - Intronic
1163018413 19:14470554-14470576 GACTGGGGAGAGGGAGGCCCGGG - Exonic
1163129623 19:15264460-15264482 GCCTGTGGACGTGGAGGCACTGG - Exonic
1163272008 19:16260091-16260113 GCCTGGGGTGGGGGCCGGCCGGG - Intergenic
1163469215 19:17487036-17487058 GCCTCGGAAGGCGGCCGCCCTGG + Intronic
1163474339 19:17516235-17516257 GCCTGTGGAGGAGGCGGCTGAGG + Exonic
1163492143 19:17623361-17623383 GCATGGGGAGGGGGCGGGGCTGG - Intronic
1163556327 19:17995248-17995270 GCCTGGGGAGGTTGAGGCTGCGG - Intronic
1163577929 19:18121645-18121667 GACAGGGTAGGTGGCTGCCCAGG - Intronic
1163764601 19:19155790-19155812 GCTGGGGGAGGTGGCAGCACAGG + Intronic
1164575849 19:29404888-29404910 GCCTGGGGAGGGGGCGGTGCCGG + Intergenic
1164676064 19:30102387-30102409 GCCTGGGGACATCGCGTCCCAGG + Intergenic
1164693205 19:30226036-30226058 GGGCGGGGAGGCGGCGGCCCAGG - Intergenic
1165058862 19:33195158-33195180 GCCTGGAGACGAGGGGGCCCCGG + Intronic
1165322876 19:35097001-35097023 GCCTGGGTGGGTGGCTGCCTGGG + Intergenic
1165395228 19:35560220-35560242 CCCTGGGGAGGTGGCAGTCACGG + Intronic
1165420844 19:35721214-35721236 GCCGGGGGAGGTGGAGGGGCTGG - Exonic
1165793580 19:38506230-38506252 GCCTGGGGAGGGGCTGGCCTGGG + Intronic
1165900015 19:39164989-39165011 CATTGGGGAGGTGGGGGCCCCGG + Intronic
1165912230 19:39236654-39236676 GCCAGTGGTGGAGGCGGCCCCGG + Intergenic
1165921097 19:39298245-39298267 GCCAGTGGTGGAGGCGGCCCCGG - Exonic
1166167920 19:41005371-41005393 GCATGGGGAGGTAGAGACCCAGG + Intronic
1166213220 19:41320476-41320498 GGATGGGGAGGTGGAGGCACAGG - Intronic
1166232288 19:41431977-41431999 GCCTGGGGAGGTAAAGGCTCAGG - Exonic
1166393694 19:42424001-42424023 GCCTGGGGTGGGGGCGGGCCAGG + Intronic
1166525984 19:43510055-43510077 GCCTGGGGATGTGGCTTCCACGG + Intronic
1166707198 19:44914651-44914673 GGCTGGGGAGGGGGCGGGGCAGG - Exonic
1166709303 19:44926747-44926769 GGCTGGGGAGGGGGCGGGGCAGG - Intergenic
1166874591 19:45889953-45889975 GCCTGTGGAGGGGGCGGGGCAGG + Intergenic
1167113317 19:47474494-47474516 GCCTAGGGGGTTGGGGGCCCAGG - Intergenic
1167269321 19:48498784-48498806 GCCCGAGGAGGTGGCGGCGGGGG + Exonic
1167349375 19:48965078-48965100 GCTTGGGGGGGTTGGGGCCCTGG - Intergenic
1167529002 19:50003173-50003195 GCCTGGGGAGGTGGAAGGCATGG - Intronic
1167577041 19:50322904-50322926 GACTGGGGAGGTAGCTGCCGGGG - Intronic
1167649007 19:50719531-50719553 GCCCGGGGAGGGGGCGGGCGGGG + Intergenic
1167843245 19:52139341-52139363 GCCTGGGGAGGGGAAGGACCCGG + Intronic
1168072829 19:53962312-53962334 CCCTGGGGCGGAGGCGGCGCGGG + Intergenic
1168154460 19:54465153-54465175 GCCTGGGGGGGCTGCGTCCCGGG + Exonic
1168202323 19:54825115-54825137 ACCTGGGGAGGTGGAAGCCTTGG + Intronic
1168207129 19:54859166-54859188 ACCTGGGGAGGTGGAAGCCTTGG + Intronic
1168305521 19:55433194-55433216 GCTGGGGCAGGTGGTGGCCCGGG + Exonic
925040932 2:732312-732334 GCCCGGGGGGGTCACGGCCCGGG + Intergenic
925041064 2:732663-732685 GCCCGGGGGGGTCACGGCCCGGG + Intergenic
925041136 2:732847-732869 GCCCGGGGGGGTCACGGCCCGGG + Intergenic
925041145 2:732863-732885 GCCCGGGGGGGTCACGGCCCGGG + Intergenic
925097771 2:1220851-1220873 GCCCGTGGAGGGGGCGGCCCAGG - Intronic
925121423 2:1421529-1421551 TCCTGGGGAGGTGGGGGGCGGGG + Intronic
925263542 2:2548139-2548161 GCCTGGGAGAGTGGGGGCCCTGG - Intergenic
925847314 2:8045444-8045466 GGCTGGGCAGTTGGGGGCCCAGG - Intergenic
926117917 2:10224939-10224961 GCCTGTGGGGGTGGGGGCACGGG - Intergenic
926141040 2:10368648-10368670 GCCTGGGGAATGGGCGGTCCAGG - Intronic
926360211 2:12079670-12079692 GACTGGGGAGGTGCTGGCCACGG - Intergenic
926812690 2:16770593-16770615 GCCTGGGGAAGAGGCTGCTCAGG + Intergenic
926957754 2:18319989-18320011 GCATGGGGAGGTGGTGGAGCAGG + Intronic
927150246 2:20191432-20191454 CTCTGGGGAGGGGCCGGCCCTGG + Intergenic
927430972 2:23025905-23025927 GCCTGGGGACTTGGCTGCCTTGG - Intergenic
927606696 2:24491947-24491969 GCGTGGGGAGCGGGCGCCCCGGG + Exonic
927702567 2:25277317-25277339 GCCTGGGAACGGGGAGGCCCCGG - Intronic
928122063 2:28590721-28590743 GCCTGGGCAGGAAGGGGCCCTGG + Intronic
930124170 2:47783346-47783368 GCCTGGGGAAGGAGAGGCCCCGG - Exonic
931253487 2:60552383-60552405 GCCGGGGGAGGAGGCGGCCGGGG - Intronic
931741070 2:65244862-65244884 GCCTGGGGAGGTTGAGGCTGTGG + Intronic
932081965 2:68723667-68723689 GCCTGTGGAAGTGATGGCCCTGG + Intronic
932463355 2:71897482-71897504 GGCTGTGGAGGTGGAGGCCTAGG - Intergenic
932626588 2:73301234-73301256 GCCTGGGGAGGTGACCCCCAGGG - Intergenic
932648748 2:73532497-73532519 GCCTGGGGCAGTGGTGGCCATGG - Intronic
934080555 2:88464113-88464135 GCCTGGGCAGGGGGTGGCCGGGG - Intergenic
934718058 2:96554592-96554614 TCCTGGGCAGGTGGGCGCCCTGG + Intergenic
935717517 2:105952288-105952310 GCCTGGGGAGCTGCTGGCCAAGG - Intergenic
936147174 2:109987709-109987731 GACGGCGAAGGTGGCGGCCCGGG - Intergenic
936197518 2:110383774-110383796 GACGGCGAAGGTGGCGGCCCGGG + Intergenic
936221995 2:110611037-110611059 GCCGGGGGCGGTGGCGGCGGCGG - Intergenic
936532059 2:113283303-113283325 GCCTAGGGAGGTGGAGAACCTGG - Intergenic
936612034 2:114010872-114010894 GCCTGGGGAGGTTGAGGGTCTGG + Intergenic
937113862 2:119389338-119389360 GCCTGGGGAGGTTGAGGCTGCGG + Intergenic
937512548 2:122612135-122612157 GCCTGTGGTGGTGGTGGCCATGG + Intergenic
937982185 2:127622265-127622287 GCCTGGGGAGGCCGAGCCCCAGG - Intronic
938863983 2:135399192-135399214 GCCTGGGGAGCTGGGAGACCAGG - Intronic
940402294 2:153261828-153261850 ACCTGGGGTGGTGGTGGCCACGG - Intergenic
940646816 2:156400427-156400449 GCCTGGGGAGGTGCCAGCTCCGG + Intergenic
940816079 2:158299200-158299222 GCCTGGGGAGGTGTAGGTCTTGG - Intronic
941995744 2:171600607-171600629 GCCTATGGAGGAGGTGGCCCAGG + Intergenic
942460123 2:176162777-176162799 GCATAAGGGGGTGGCGGCCCCGG + Intronic
942678305 2:178451118-178451140 GTCGGAGGAGGTGGCGGCGCTGG - Exonic
943302781 2:186224015-186224037 GCCTGGGGCAGTGGTGGCCATGG + Intergenic
944581511 2:201136955-201136977 CCCTGGGGAGGAGGCTGCCCTGG - Intronic
946135519 2:217643814-217643836 GGCTGGGGAGATGGCGGATCTGG + Intronic
946363018 2:219230362-219230384 GCCTGGGGAGGCTCTGGCCCGGG + Exonic
947743050 2:232493672-232493694 GCCTGTGGAGGTGGCGACATCGG - Intergenic
948624668 2:239261706-239261728 GCCTGGTGAGATGGTGGCCCAGG + Intronic
948899631 2:240949767-240949789 CCCTTGGGAGGAGGGGGCCCTGG + Intronic
948927316 2:241107597-241107619 GACTGGGCAGGTGGCGGCCCAGG + Intronic
949025362 2:241765254-241765276 GCCTGGGGAGATGGGAGCCCCGG + Intronic
949042239 2:241854710-241854732 GCCTGCGGTGGTGGGGCCCCTGG - Intronic
949063243 2:241973799-241973821 GCCTGGGGAGTTGGGAGCACTGG + Intergenic
1168830445 20:842427-842449 GGTTTGGGAGGTGGCGGCCTGGG + Intronic
1168959305 20:1857777-1857799 GTGTGGGGAGGTGGAGGCTCTGG - Intergenic
1169119135 20:3084820-3084842 GGCTGGGGACCTGGCGGCCGTGG - Intergenic
1169231141 20:3889538-3889560 GGCTGGGGAGCAGGCGGCCGGGG + Exonic
1169267460 20:4175280-4175302 ACCTGGGGAGGTGGCTGGGCTGG - Intronic
1169278090 20:4246955-4246977 GCCTGCGGAGGTTGCAGCCATGG + Intronic
1169889170 20:10434131-10434153 GCCTCTGGCGGTGGCGGCCTGGG - Exonic
1170062813 20:12276878-12276900 GCCTGGGGCAGTGGTGGCCATGG + Intergenic
1170613245 20:17930402-17930424 GACTGGGCAGGTGGTGGCCCAGG - Intergenic
1171365127 20:24617944-24617966 GCCTGGGGAGGGGGAGACCCCGG + Intronic
1172123334 20:32611133-32611155 GCCTGGGGAAGAGGTGGCTCTGG + Intergenic
1172289650 20:33766868-33766890 GCCTGGGGCTGTGGCGCACCCGG - Exonic
1172654753 20:36529904-36529926 GTCTGGGAAGGTGCCAGCCCTGG - Intergenic
1172759460 20:37311845-37311867 GCATGGGGAGGTAGAGGCACGGG + Intronic
1172844084 20:37919404-37919426 CCCTGGGGAGGAGAGGGCCCTGG + Intronic
1173479956 20:43390559-43390581 GCATGGGGTGGGGGAGGCCCCGG + Intergenic
1173495122 20:43513262-43513284 GACTGGGGAGGTGCAGGGCCTGG + Intronic
1173669733 20:44790393-44790415 GCCTGGGGAGGAGGTAGCCTGGG - Intronic
1173812039 20:45962003-45962025 GGGTGGGGAAGTGGAGGCCCGGG - Intronic
1174075337 20:47931516-47931538 GCCTGGGGAGTAGGAGGCCTAGG + Intergenic
1174303702 20:49600446-49600468 GCCTGGGGATCTGGCAGCTCTGG + Intergenic
1174353690 20:49984674-49984696 GGCTAGGGAGGGGGCGGACCCGG - Intronic
1174568131 20:51481613-51481635 GTCTGCGGGGGTGGGGGCCCAGG + Intronic
1174585754 20:51606798-51606820 GCCTGGGGAGGTCGAGGCTACGG + Intronic
1175215982 20:57391911-57391933 GCCTGGGGCGGGGGCGGCAGCGG - Intronic
1175402138 20:58706984-58707006 GCCTGGTGTGGGGGCTGCCCAGG + Intronic
1175806175 20:61830461-61830483 GCCTTGGGAGGTGGTGGCCCTGG - Intronic
1175855878 20:62120888-62120910 TCCTGGGGAGGTGGAGGCAGAGG - Intergenic
1175926393 20:62473603-62473625 TCCTGGGGAGGGGAGGGCCCGGG - Intronic
1176115496 20:63430223-63430245 ACAAGGGGAGGGGGCGGCCCTGG + Intronic
1176119931 20:63449831-63449853 GCCTGGGGTGATGGGGGCCCCGG - Intronic
1176214309 20:63941077-63941099 ACCTGGGGACGGGGCGGCCCCGG - Intronic
1176268291 20:64222093-64222115 GCCTGGGGAGGAACAGGCCCTGG + Intronic
1176868794 21:14071323-14071345 GCCTGGGGAAGTTGCGGGCAGGG + Intergenic
1178840555 21:36134965-36134987 GCGTGGGCAGGGGGCGGGCCCGG + Exonic
1178856620 21:36255520-36255542 GCCTGGGGAGGTCGAGGCTATGG - Intronic
1178872182 21:36385738-36385760 GCCCGGGGAGGGGCCCGCCCCGG - Intronic
1179289508 21:40006237-40006259 GCCTGGGGAGAGGGAGGGCCTGG + Intergenic
1179549622 21:42135675-42135697 GTCTGGGGAAGTGGCCGGCCGGG + Intronic
1179626704 21:42653358-42653380 GCGTGGGGAGGCGACGGCTCCGG + Intergenic
1179810066 21:43864884-43864906 GCTGGGGGAGGGGGCGGGCCGGG - Intergenic
1179982287 21:44901752-44901774 GGCTGGGGAGGTGGCAGGCTGGG + Intronic
1180843128 22:18968436-18968458 AGGTGGGGAGGTGGAGGCCCAGG + Intergenic
1180951929 22:19724364-19724386 GCCTGCGGAGGCTGCGGGCCCGG + Exonic
1180971991 22:19820596-19820618 ACCTGAGGAGCTGGCGCCCCTGG + Exonic
1181058344 22:20270297-20270319 CTGTGGGGAGGTGGAGGCCCAGG - Intronic
1181572242 22:23773874-23773896 GCCTGGTGAGGAGGCAGGCCTGG + Intronic
1181622147 22:24098415-24098437 GCCAGGGGAGGGGGCAGGCCAGG + Intronic
1181639496 22:24189233-24189255 GCCTGGGGAGGGAGCATCCCCGG - Intergenic
1181716927 22:24737823-24737845 GCCTGTGGTGGTGGTGGCCATGG + Intronic
1182279179 22:29208282-29208304 TCCTGGGGAGGGGGTGGCCTGGG + Intronic
1182355383 22:29720353-29720375 TCATGGGCCGGTGGCGGCCCCGG - Exonic
1182511624 22:30824245-30824267 GCCTGGGGAGGAGGCGGCTCAGG + Intronic
1182692857 22:32175971-32175993 GCCCGGGGAGGGGGAGGCGCTGG + Intergenic
1183264745 22:36818276-36818298 GCCTTGGGCTGTGGTGGCCCTGG + Intronic
1183384288 22:37506102-37506124 GGCTGGGAACGTGCCGGCCCTGG - Intronic
1183474120 22:38026575-38026597 GCCGGGGGAGGGGGCGGCTTTGG - Intronic
1184019818 22:41813451-41813473 GACTGGGGTGGAGGTGGCCCGGG + Intronic
1184098444 22:42329148-42329170 GCCTGAGAAGGTGCTGGCCCTGG - Intronic
1184106324 22:42369281-42369303 GTCTGGGGAGGGGCCGGACCGGG + Intergenic
1184263001 22:43329985-43330007 GCCTGGGGAGCTGGAGGACATGG + Intronic
1184274686 22:43403724-43403746 GCCTGGGGAGGAAGAGGCTCAGG + Intergenic
1184402563 22:44282348-44282370 GCCAGGGGAGGTGGAGGCAAGGG - Intronic
1184465777 22:44668463-44668485 GCCGGGGCAGGGGGCGTCCCGGG - Intergenic
1184902633 22:47457238-47457260 CCCTGGGGAGTTCCCGGCCCAGG + Intergenic
1185222464 22:49635943-49635965 GCCTGGGGAGGGGAGGGTCCAGG + Intronic
950099008 3:10345988-10346010 GCCTGGGGTGGTGGGGGCTGGGG - Intronic
950211720 3:11128303-11128325 GCCAGGCGAGGTGGCTGGCCAGG + Intergenic
950265192 3:11568343-11568365 GCCCTGGCAGCTGGCGGCCCTGG - Intronic
950831640 3:15880104-15880126 CCCTGGGGAGGAGGCTGCCCTGG + Intergenic
950868763 3:16211136-16211158 GCCCGGAGAGGTGGTGGCCATGG + Exonic
952287292 3:31981206-31981228 GCCCGCCGCGGTGGCGGCCCCGG + Exonic
952725790 3:36582828-36582850 GCCTGTGGTGGTGGCGGCCATGG + Intergenic
953662178 3:44899342-44899364 GCCTGAGGAGGTGGCTGGCAGGG - Intronic
953905769 3:46867619-46867641 GCCTGCGGAGACTGCGGCCCAGG - Intronic
954105982 3:48410108-48410130 GCCTGGGGAGGTGGCACCTGGGG - Intronic
954186108 3:48918436-48918458 GCCTGGTGTGGTTGCGGCTCTGG + Exonic
954389245 3:50260283-50260305 GCCTGGGCAGAGGGCGGGCCGGG + Intergenic
954390925 3:50267582-50267604 GCGTGGGGCGGTGGCTGGCCTGG + Intronic
954661602 3:52229626-52229648 GCCTGGGGAGGTGAGGCCCTGGG + Intronic
955961236 3:64343249-64343271 GCCTGGGGTGGTGGAGGGGCAGG - Intronic
957438930 3:80216990-80217012 GGTTAGGGAGGAGGCGGCCCTGG + Intergenic
959913676 3:111793302-111793324 GCCTGGGGCAGTGGTGGCCATGG - Intronic
960498973 3:118412173-118412195 GCCTGGGGCAGTGGAGGCCATGG + Intergenic
960784952 3:121362501-121362523 GCCTGGGGTGGTGGCGGCTATGG - Intronic
961152429 3:124650610-124650632 GCCTGAGAAGGTGGCAGCTCTGG + Intronic
961531707 3:127544177-127544199 GCCTGGGGTGGGGGCAGGCCAGG + Intergenic
961536165 3:127572289-127572311 GCCTGGGGAGGTCTCAGCCCTGG - Intergenic
962400973 3:135058399-135058421 TCCTGGGGAGGAGGAGGGCCAGG + Intronic
963091625 3:141487667-141487689 GCCCGAGGAGGTGGCGGGCTGGG + Intronic
963827286 3:149970200-149970222 GCTGTGGGAGGCGGCGGCCCCGG - Intronic
966194308 3:177298114-177298136 GCCTGGGGAGAGAGCTGCCCAGG + Intergenic
967193179 3:187003011-187003033 GACTGGCAAGGTGGAGGCCCAGG + Intronic
967873587 3:194251619-194251641 GCCTGGTCAGCTGGCCGCCCAGG + Intergenic
967937358 3:194739600-194739622 GCCTGTGGAGGGGGCAGCACCGG + Intergenic
968090842 3:195897293-195897315 GTCTGGGGAGGAGGCTGGCCAGG + Intronic
968096251 3:195932781-195932803 GCCTGGGGTGGTAGCGGCCATGG + Intergenic
968445791 4:651395-651417 GCCTTGGGAGGAGGAGGGCCTGG + Intronic
968512835 4:1002983-1003005 GGCTCTGGAGGGGGCGGCCCGGG + Intronic
968521298 4:1035921-1035943 GCCTGGGGTGGGGTGGGCCCAGG + Intergenic
968656220 4:1779559-1779581 GCCAGGGGAGGTGGCAGGCCTGG - Intergenic
968835881 4:2963877-2963899 GCCTGCGGAGGCGGCGGCGGCGG + Exonic
968939893 4:3632298-3632320 CCCTGGAGAGGAGGCGGCCGAGG - Intergenic
968966079 4:3769663-3769685 GCCTGGGGAGGGGTCAGCCCTGG + Intergenic
969455864 4:7299214-7299236 GCCAGGCGAGGTGGGGGCCGAGG + Intronic
969651663 4:8471674-8471696 GCCTGGGCAGGCGGAGGTCCTGG + Intronic
969663774 4:8545359-8545381 GGCCGGGGAGGGGGCGCCCCAGG - Intergenic
969871244 4:10106517-10106539 GCCTGGGGAGGAGGTCGTCCAGG - Intronic
970001901 4:11372841-11372863 TCCTGTGGCGGCGGCGGCCCGGG - Intergenic
970202896 4:13627532-13627554 GGCGGGGGAGGCGGCGGCGCCGG + Exonic
970667426 4:18353840-18353862 GCCTGAGGTGGTGGCGGCTATGG - Intergenic
971709449 4:30092805-30092827 GCCTGGGGCCCTGCCGGCCCCGG + Intergenic
972270176 4:37503014-37503036 GCCTGGGGAATGGGCGTCCCTGG + Intronic
972468721 4:39383854-39383876 GCCTGTGGTGGTGGTGGCCATGG - Intergenic
972579300 4:40380522-40380544 GTCTGGGGAGGCGGCAGCCATGG + Intergenic
973348596 4:49083292-49083314 GCCTGGGGCAGTGGTGGCCATGG + Intergenic
975342759 4:73259294-73259316 GGCTGGAGAGGAGCCGGCCCCGG + Intergenic
976728442 4:88239652-88239674 GCCTGTGGAGGTGATGGCCATGG - Intergenic
977166877 4:93710851-93710873 GCCTGGGGCAGTGGTGGCCATGG - Intronic
978258345 4:106719189-106719211 GCCTGGGGCAGTGGTGGCCATGG + Intergenic
978595678 4:110374558-110374580 TCCTGGGGAGGTGCCTGTCCTGG - Intronic
978777239 4:112516235-112516257 GGCGGGGGAGGAGGGGGCCCGGG - Intergenic
979156096 4:117392469-117392491 GCTTGGGGAAGTGGTGGCCATGG + Intergenic
979395083 4:120178127-120178149 GCCTGGGGTGGTGGTGGCCATGG + Intergenic
981366662 4:143912132-143912154 GCCGGCGGAGGTGGCGGCGGAGG - Intergenic
982911606 4:161149104-161149126 GCCTGGGACGGTGGTGGCCAGGG + Intergenic
983938549 4:173519480-173519502 GCGTGGGGAGGGGGCGGGCTGGG - Intergenic
984206548 4:176793061-176793083 GCCGGGGGAGGTGGGGCCGCCGG - Intergenic
985646619 5:1088030-1088052 GGCTGGGGAGGGGGAGGCACGGG - Intronic
985681434 5:1257892-1257914 GCCTGTTGAGGTGGAGGCCCGGG + Intronic
985951622 5:3225794-3225816 GCCTGGGGAGGCCCCGGCTCAGG + Intergenic
986180751 5:5390918-5390940 TCCTGGGGAGGAGGAGGCACCGG + Intergenic
986315315 5:6583081-6583103 GCCTAGGGCGGCGCCGGCCCGGG + Intergenic
986330589 5:6713858-6713880 GCCTGGGCCGGTGGCGGCGGCGG - Intergenic
987113155 5:14705696-14705718 GCTTGTGGATGTGGCAGCCCTGG + Exonic
987303386 5:16616877-16616899 GCCTGGGGCGGTGGCGGCGACGG + Exonic
987707382 5:21473620-21473642 CCCTGGGGAGGAGGTGGCGCCGG - Intergenic
990578938 5:57150156-57150178 GCCTGTGGTGGTGGTGGCCATGG - Intergenic
990933073 5:61115178-61115200 GCCTGGGGTGGTGGTGGCCATGG - Intronic
993155647 5:84218790-84218812 GCCTGGGGCAGTGGTGGCCATGG + Intronic
993495412 5:88603235-88603257 GCCGGGGGAGGGGGCGGGCGGGG - Intergenic
995697748 5:114899339-114899361 GCCTGGGATGGTGGTGGCCATGG - Intergenic
996329320 5:122311956-122311978 GCCTGAGGGCGCGGCGGCCCCGG + Intronic
996831324 5:127743590-127743612 GGCTGAGCAGGTGGTGGCCCTGG - Intergenic
997476634 5:134146309-134146331 TCCTGGGGAGCTGGGGACCCGGG - Exonic
998176277 5:139904065-139904087 GCGTGGGGACGCGGCCGCCCGGG + Intronic
999180221 5:149664951-149664973 CCCTGGGGAGCTGATGGCCCTGG - Intergenic
999274414 5:150319400-150319422 GGCAGGGGAGGGGGCTGCCCAGG + Intronic
999362050 5:150993446-150993468 ACCTGCGGAGGTGGGGGACCAGG + Intergenic
1000463341 5:161547922-161547944 GCGTGCGGAGCTGGCGCCCCCGG + Intronic
1001177702 5:169487141-169487163 GCCTGGGGTGGTGATGGCCATGG + Intergenic
1001425346 5:171618857-171618879 GCCTGGTGAGGAGGGGGCCCAGG - Intergenic
1001486013 5:172120155-172120177 GCCAAGGGAGGTGGCTCCCCTGG - Intronic
1001933384 5:175688369-175688391 GCCTGGGGAGGTGGCAGGAAAGG - Intergenic
1002103927 5:176870591-176870613 CCCTGGGGAGGTGGGGGCTGAGG + Intronic
1002283276 5:178145919-178145941 CACTGGGGAGGTGGAGGTCCAGG - Intronic
1002469506 5:179427134-179427156 GCCTGAGCAGGCGGAGGCCCTGG + Intergenic
1002741216 5:181436974-181436996 GCCGGGGGAGGTGGCGGGCTGGG + Intergenic
1003108204 6:3231363-3231385 GCCTGGGAAGCCAGCGGCCCCGG + Intronic
1003139061 6:3456454-3456476 GCCCGGGGACGCGGCGGCCTCGG - Exonic
1003642668 6:7888637-7888659 GGGTGGGGAGGTGGGGGGCCGGG + Intronic
1003644195 6:7901250-7901272 GCCTGGGGAGGTGCCAGGCTAGG - Intronic
1004478422 6:15996173-15996195 GCTTGGTGAGCTGGCTGCCCTGG - Intergenic
1004924419 6:20403558-20403580 GACTGGGGAGGAGGCGGCGGCGG + Intronic
1004979594 6:21008407-21008429 GCCCGTGGAGGTGGAGACCCAGG + Intronic
1006019865 6:31111688-31111710 TCCTGGGGAGGTGGAGGCCCTGG - Exonic
1006255707 6:32830398-32830420 TCCTGGTGAGGTGACGGCGCTGG - Exonic
1006258239 6:32848050-32848072 CCCTGGCGAGGTGACGGCGCTGG - Exonic
1006407060 6:33851588-33851610 GCCAGTGGTGGTGGTGGCCCCGG + Intergenic
1006554189 6:34851890-34851912 GCCTGGGGCAGTGGTGGTCCTGG - Intronic
1006631990 6:35436531-35436553 GGCTGGGGAGCTGGGGGCTCAGG - Intergenic
1006725410 6:36196547-36196569 GCCTGGCGCGGCGGCGGCCGGGG - Intergenic
1007180483 6:39925998-39926020 GCCTGGGGAGATGCTGGCCTGGG - Intronic
1007424075 6:41735542-41735564 GACAGCGGAGGCGGCGGCCCGGG - Intronic
1007473547 6:42105406-42105428 GACTGGGGAGGTGGTGGAGCGGG - Exonic
1007784205 6:44270788-44270810 GGCGGCGGCGGTGGCGGCCCCGG + Exonic
1008539797 6:52536811-52536833 GCCAGGTGAGGAGGCAGCCCAGG + Intronic
1008641982 6:53473802-53473824 GCCTGGGGTGGTAGTGGCCATGG - Intergenic
1008956408 6:57221597-57221619 GACTGGGGAAGGGGCGACCCGGG - Intronic
1009020844 6:57946892-57946914 CCCTGGGGAGGAGGAGGCGCCGG + Intergenic
1010043318 6:71412668-71412690 GCCTGGTGAGGTGGCTGTACTGG - Intergenic
1011607370 6:89118082-89118104 GCCGGGGGCGGGGGCGGCGCCGG + Intergenic
1012887149 6:104859400-104859422 GCCAGGGGAGTTCGGGGCCCGGG + Intronic
1014250417 6:119110176-119110198 GCCTGGGGTGATGATGGCCCAGG - Intronic
1014862310 6:126484890-126484912 GCCTGGGCTGGTGGTGGCCAAGG + Intergenic
1015030358 6:128587006-128587028 GCCTGGGGTGGTGGTGGCAATGG + Intergenic
1015536141 6:134269406-134269428 GCCAGGTGAGGTGGAGGCCGAGG + Intronic
1016820695 6:148343231-148343253 ACCTGGGGAGGGGGCGGCGCAGG + Intronic
1017019815 6:150130990-150131012 ACCTGGGGAGGTGGGTGACCTGG + Intergenic
1017324702 6:153131420-153131442 GCCCGGGGAGGGGGCGGGGCCGG - Intergenic
1017842260 6:158231967-158231989 GCCCGGGCAGGCGGCGGCTCCGG + Intergenic
1018073839 6:160191682-160191704 GCCTGGGGATGTGTCTGCCAGGG - Intronic
1018726060 6:166614395-166614417 GCCTGGGTAGGAAGCGGGCCGGG - Intronic
1018743616 6:166748293-166748315 GCCTGGGGAGGTGGTGGCGCTGG - Intronic
1018743711 6:166748611-166748633 GCCTGAGGAGGTGGGGGCCCAGG - Intronic
1019148025 6:169987117-169987139 GCCTGGGCAGGTGTGGGCCTCGG - Intergenic
1019246331 6:170712671-170712693 GCCGGGGGAGGTGGCGGGCTGGG + Intergenic
1019332249 7:466241-466263 GCCTGGAAAGGTGGTGGCCCAGG + Intergenic
1019365135 7:629281-629303 CCCTGGGGTGGTGGCGCCCTGGG - Intronic
1019365185 7:629449-629471 CCCTGGGGTGGTGGCGCCCTCGG - Intronic
1019365219 7:629561-629583 CCCTGGGGTGGTGGCGCCCTGGG - Intronic
1019365271 7:629729-629751 CCCTGGGGTGGTGGCGCCCTCGG - Intronic
1019365306 7:629841-629863 CCCTGGGGTGGTGGCGCCCTGGG - Intronic
1019365324 7:629897-629919 CCCTGGGGTGGTGGCGCCCTGGG - Intronic
1019365343 7:629953-629975 CCCTGGGGTGGTGGCGCCCTGGG - Intronic
1019365362 7:630009-630031 CCCTGGGGTGGTGGCGCCCTGGG - Intronic
1019395419 7:815797-815819 GCCTGGGGAGGAGGGGCCGCGGG + Intergenic
1019430411 7:996487-996509 GGCTGGGCAGGAGGCGGCCCCGG + Intergenic
1019492335 7:1321313-1321335 GCCTGGGGAGGGGGCCTCCCTGG + Intergenic
1019551340 7:1604082-1604104 GCCGGGCGAGCGGGCGGCCCGGG - Intergenic
1019587427 7:1813097-1813119 GGCAGGGGAGGTGCCGGCCCCGG + Intergenic
1020002178 7:4762295-4762317 GGCTGGGGTGGTGGTGGCCGTGG - Exonic
1020120595 7:5501047-5501069 GCTGGCAGAGGTGGCGGCCCAGG + Exonic
1020204793 7:6105576-6105598 GCCTGGGGAGGGGGCGCCCAAGG - Intronic
1020224840 7:6272271-6272293 GCCGAGGGAGGGGGCGGGCCGGG - Intronic
1020289971 7:6715780-6715802 GCCTGGGGAGGTGGAGGAGGTGG - Intergenic
1020418091 7:7969045-7969067 GCCTGGAGCGGTGGCGGCGGCGG + Exonic
1021605929 7:22409711-22409733 GCCTGAGGTGGTGGAGTCCCAGG + Intergenic
1021868237 7:24979737-24979759 GCCCGGGGAGGCTCCGGCCCTGG - Intronic
1022002979 7:26243860-26243882 GCCTGGGGAGGTCGAGGCTGTGG - Intergenic
1022103583 7:27183419-27183441 GCCTTGGGAAGGGGCAGCCCAGG - Intronic
1022989660 7:35695044-35695066 GGCTGGGCCGGGGGCGGCCCAGG + Exonic
1023220564 7:37916914-37916936 GCCTGGGGGTGGGGCGGCCGAGG - Exonic
1023825742 7:44007596-44007618 GCCTGGGGAGGTGGAGGAGGTGG + Intronic
1024209570 7:47192025-47192047 GCCTTTGGAGGTGCCGGCCATGG - Intergenic
1024579773 7:50792788-50792810 GCCTGGGAGGGTGGGCGCCCAGG - Intronic
1026009981 7:66629009-66629031 GCGGGCGGAGGCGGCGGCCCCGG - Exonic
1026089314 7:67286447-67286469 GCCTGGGGAGGTGGAGGAGGTGG + Intergenic
1026724970 7:72864053-72864075 GCCTGGGGAGGTGGAGGATGTGG - Intergenic
1026805701 7:73428877-73428899 GCCTGGGGAGGTCAGGGCCCTGG - Intergenic
1027118902 7:75501765-75501787 GCCTGGGGAGGTGGAGGAGGTGG + Intergenic
1027272919 7:76533844-76533866 GCCTGGGGAGGTGGAGGAGGTGG - Intergenic
1027326368 7:77052928-77052950 GCCTGGGGAGGTGGAGGAGGTGG - Intergenic
1028408288 7:90500134-90500156 GCCTGGGGAGGTCGAGGCTGTGG + Intronic
1028762713 7:94512327-94512349 GCCTGGGCTGCTGGAGGCCCAGG - Intronic
1028868056 7:95736396-95736418 GCCTGGGGTGGTGGTAGCCATGG - Intergenic
1029397751 7:100319818-100319840 GCCTGGGGAGGTGGAGGATGTGG + Intronic
1029447304 7:100620965-100620987 GCCAGTGGAGGAGGTGGCCCCGG + Exonic
1029459655 7:100687527-100687549 GCCTCGGGAGGTGCCAGCCAGGG + Exonic
1029640427 7:101816450-101816472 GACCGGGGAGGGGGCGGCCCCGG + Intronic
1029708208 7:102286497-102286519 GCCCGCGGTGGTGGTGGCCCCGG - Intronic
1029718590 7:102348252-102348274 GCCTGGGGAGGTGGAGGAGGTGG - Intergenic
1029754026 7:102561003-102561025 GCCTGGGGAGGTGGAGGAGGTGG + Intronic
1029771976 7:102660093-102660115 GCCTGGGGAGGTGGAGGAGGTGG + Intronic
1031998244 7:128246890-128246912 GCCTGTGGAGAGGGCAGCCCAGG + Intronic
1032095040 7:128933773-128933795 GCCTGTGGAGGAAGCTGCCCGGG - Intergenic
1032199281 7:129808031-129808053 GGCTGGAGAGGTGGTGGCCTGGG - Intergenic
1032904926 7:136353557-136353579 GCCTGGAGAGGTGGCTGCTGAGG - Intergenic
1033097393 7:138442761-138442783 CCCTGGGGAGGAGGCTTCCCTGG + Intergenic
1033369762 7:140697227-140697249 GCCTAGGGAGGGCGCGGTCCAGG + Intronic
1033589313 7:142796925-142796947 AACTGGGGAGGGGGCGCCCCGGG + Intergenic
1033654377 7:143362827-143362849 GGCCGGGGAGGGGGCGGCCCGGG + Intergenic
1033686050 7:143642517-143642539 TCCAGGGGAGGTGGAGGTCCAGG + Intronic
1033689690 7:143724798-143724820 TCCAGGGGAGGTGGAGGTCCAGG - Exonic
1033698563 7:143815104-143815126 TCCAGGGGAGGTGGAGGTCCAGG - Intergenic
1034130537 7:148712025-148712047 GCCTGTGGAAGTGGTGCCCCAGG - Intronic
1034269208 7:149795518-149795540 GCCTGGGGAGGGAGGGGCCAGGG - Intergenic
1034278976 7:149838572-149838594 GCGGGGGGAGGGGGCGGCACGGG + Exonic
1034412315 7:150947846-150947868 GCCAGGGGAGGTGTCGGCCTTGG - Exonic
1034449330 7:151129030-151129052 GCCTGGGATGGTGGAGGACCAGG + Intronic
1034530514 7:151693424-151693446 GCCCGGGGAGGTGATGGGCCTGG - Intronic
1035125963 7:156607816-156607838 GGCAGAGGAGGCGGCGGCCCGGG + Intergenic
1035266395 7:157692284-157692306 GCCTGGGGAGGTGGGGGGTGTGG - Intronic
1035338284 7:158143969-158143991 GTCTGGGCAGGTGGTGGCCCGGG - Intronic
1035375499 7:158404636-158404658 GGCTGGGGAGCTGGAGGCCGAGG - Intronic
1035375520 7:158404694-158404716 GGCCGGGGAGCTGGAGGCCCGGG - Intronic
1035375580 7:158404842-158404864 GGCTGGGGAGCTGGAGGCCGGGG - Intronic
1035501741 8:95018-95040 GCCGGGGGAGGTGGCGGGCTGGG - Intergenic
1035519490 8:265945-265967 ACCTGAGGAGGGGGAGGCCCGGG + Intergenic
1035519542 8:266079-266101 ACCTGAGGAGGGGGCGGCCAGGG + Intergenic
1035519682 8:266439-266461 ACCTGGGGAGGGGGCGGCCGGGG + Intergenic
1035720061 8:1784949-1784971 GCCTGGGGTGGGGTCGGCCAGGG + Exonic
1037545882 8:19921773-19921795 GCCTGGGGAGGTTGAGGCTGTGG + Intronic
1037623592 8:20588717-20588739 TCTTGGGGAGGTGGGGACCCAGG + Intergenic
1037829154 8:22177880-22177902 GCCTCAGGAGGTGGAGTCCCTGG + Exonic
1038041444 8:23727124-23727146 GCCGGGGCGGGCGGCGGCCCCGG + Intergenic
1038341645 8:26691251-26691273 GGCTGGGGTGATGGGGGCCCAGG + Intergenic
1038797532 8:30723106-30723128 GCCTGGGGAACTTGCGGTCCTGG - Intronic
1040537989 8:48326263-48326285 GTGTGGGGTGGTGGCGGCTCAGG + Intergenic
1040628200 8:49175990-49176012 GCCTGTGGTGGTGGTGGCCATGG + Intergenic
1040668450 8:49658501-49658523 GCCTAGGGGGATGGCGTCCCTGG - Intergenic
1043134181 8:76500572-76500594 GCCTGGGGTGGTGATGGCCATGG - Intergenic
1044241514 8:89893495-89893517 GCCTGGGGTGGTGGTGGCCATGG + Intergenic
1044569522 8:93700977-93700999 AACTGGGGAGGTGGCTGCTCCGG - Intronic
1044654651 8:94534871-94534893 GGCTGGGGAGGTGGTGGCGGTGG + Exonic
1045172483 8:99686624-99686646 GCCTGGGATGGTGGTGGCCATGG - Intronic
1047138308 8:122106819-122106841 GCCTGGGGCAGTGGTGGCCATGG - Intergenic
1047508182 8:125496244-125496266 GCCTGGGGAGGTAGAGGCTGTGG + Intergenic
1047771546 8:128033993-128034015 GGCTGGGGAGGTGGCCGGCAAGG - Intergenic
1048163507 8:132041673-132041695 GCCAGGTGAAGTGGGGGCCCAGG + Exonic
1048886636 8:138914485-138914507 GCCTGGGGAGGGGGCGCGCTTGG + Intergenic
1049102243 8:140588097-140588119 GCCTGGGGAGGAGGTGCCCATGG - Intronic
1049212404 8:141392719-141392741 CCCTGGGCAGCTGGTGGCCCAGG + Intronic
1049386260 8:142344511-142344533 GCCTGTGGAGGCAGCGGCCCCGG + Intronic
1049405527 8:142450347-142450369 GGCTGAGGAGGGGGCGACCCTGG + Intronic
1049431869 8:142569096-142569118 CCCTGGGGAGTTGGAGGGCCGGG - Intergenic
1049651691 8:143772536-143772558 GCCTCGGGAGGTGTGAGCCCCGG + Intergenic
1049710514 8:144060955-144060977 GCAAGGGGAGCTGGCAGCCCAGG + Intronic
1049733169 8:144189532-144189554 GGCTGGGCAGGTGGCCACCCAGG - Intronic
1049747232 8:144268176-144268198 GCTGGGGGAGGTGGACGCCCGGG + Exonic
1049747649 8:144269819-144269841 GCCTGGGAGGGTGGCGGGGCGGG - Intronic
1049755299 8:144308832-144308854 GCCTGGGGAAGGGGCGGCTTGGG + Intronic
1049775016 8:144400130-144400152 GGCTGGGGCGGGGGGGGCCCGGG - Intronic
1049795595 8:144496030-144496052 GGCAGGAGAGGTGGAGGCCCAGG + Intronic
1052781370 9:32784210-32784232 GACTGGGCTGGTGGTGGCCCTGG + Exonic
1052850065 9:33372859-33372881 GCATGGGGTGGTGGAGGCACAGG - Intergenic
1052941047 9:34132622-34132644 CCCTGGGGAGGAGGCTGCCCTGG - Intergenic
1053263299 9:36690341-36690363 GCCTTGGGAGCTGTCTGCCCCGG + Intergenic
1054450858 9:65402977-65402999 CCCTGGAGAGGAGGCGGCCGAGG + Intergenic
1055425523 9:76191721-76191743 GCTTGGGGTGGTGGCACCCCAGG + Intronic
1056842404 9:90009139-90009161 GCATGGGGAGGGGAAGGCCCAGG - Intergenic
1057230887 9:93320696-93320718 GGCCCTGGAGGTGGCGGCCCCGG + Intronic
1057359687 9:94361814-94361836 GCCTGTGGAGGTGGCAGCTGAGG + Intergenic
1057535467 9:95899372-95899394 GCCTGGGGAGGTTGAGGCTGCGG + Intronic
1057663655 9:97026275-97026297 GCCTGTGGAGGTGGCAGCTGAGG - Intergenic
1057758428 9:97854441-97854463 GCCTGGGAAGATGGCGGCGGCGG - Exonic
1057869878 9:98709234-98709256 GCCGGGGGAGGGGGAGGCGCTGG + Intergenic
1057999309 9:99848889-99848911 GCCTGGGGAGGTGGTGACAGAGG + Intronic
1058003991 9:99896020-99896042 GCCTGGGGTGGTGGTGGCCATGG + Intergenic
1058467521 9:105244504-105244526 CGCTGAGGAGGCGGCGGCCCGGG + Intergenic
1058492786 9:105519950-105519972 GCGGGTGGAGGTGGCGGCCCTGG + Intronic
1058820939 9:108728721-108728743 GCCTGGGGCAGTGGTGGCCATGG + Intergenic
1059041779 9:110822682-110822704 GCCTTGGGCAGTGGCGACCCTGG + Intergenic
1060221898 9:121768570-121768592 GGCTGGAGAGCTCGCGGCCCAGG - Exonic
1060602350 9:124886725-124886747 GCTTGGGGAGGTGGGGGAACAGG + Intronic
1061096375 9:128459186-128459208 GCCTGGAGCAGAGGCGGCCCTGG - Intronic
1061347980 9:130042574-130042596 GCGTGGGGGCGTGGAGGCCCCGG - Intronic
1061398472 9:130355859-130355881 GTCTGGGGTGGTGGAGGCCAGGG + Intronic
1061405696 9:130391987-130392009 GCCTGGGGAGCTGGTGACCATGG + Intronic
1061448547 9:130656062-130656084 GCCGGGGGAGGCTGAGGCCCTGG + Intergenic
1061580113 9:131531204-131531226 GCCTGGGGAAGGGGCGGGCGCGG - Intronic
1061626097 9:131841587-131841609 GCCAGGGGAGGTGGCAGGACTGG - Intergenic
1061925826 9:133805641-133805663 GGCTGGGGAGGTGGCGTTTCTGG - Intronic
1062009422 9:134259117-134259139 CCCTGGGCAGGGGGCAGCCCTGG + Intergenic
1062194265 9:135264228-135264250 TCCTGGGGAGCTGGCAGTCCTGG - Intergenic
1062230655 9:135479943-135479965 CCCGGGGGAGGCGGCGGGCCGGG - Exonic
1062254937 9:135616425-135616447 GTCTGGGGAGCTGACGCCCCGGG + Intergenic
1062322515 9:135997322-135997344 GCCCGGGGAGGTGCTGGCCCGGG - Intergenic
1062332058 9:136049205-136049227 GCCTGGAGAGGTGGTGGCAAAGG + Intronic
1062374451 9:136255655-136255677 ACCTGGGGAGGCAGCGGCCTGGG + Intergenic
1062412528 9:136432224-136432246 GCCAGGGGAGGCGGCGGGGCGGG + Intronic
1062427547 9:136512899-136512921 GCCAGGGGTGGGGGCGGCCTGGG - Intronic
1062506780 9:136881722-136881744 GCCTGGGGAGGGGTGGGACCTGG - Intronic
1062528053 9:136986126-136986148 GGCTGGGGAGCTGGGGGACCCGG - Intronic
1062530358 9:136996905-136996927 ACCTGGGAAGGGGGCGGCTCTGG + Intergenic
1062568693 9:137174610-137174632 CCCTGGGTCGGGGGCGGCCCGGG + Intergenic
1062591705 9:137277434-137277456 CCTGGGGGAGGTGGGGGCCCTGG + Intergenic
1062599250 9:137312581-137312603 GCCTGGAGAGGAGAGGGCCCTGG - Intronic
1062614621 9:137390792-137390814 GCCTGGGCAGGCGCCGGGCCAGG + Intronic
1062686623 9:137816996-137817018 GGCAGGGGAGGTGGCGGTCGAGG - Intronic
1062711295 9:137976463-137976485 GCTGGGGGAGGTGGTGGCCCTGG + Intronic
1203776270 EBV:74920-74942 TCGTGGGGTGGTGGAGGCCCAGG + Intergenic
1203607095 Un_KI270748v1:68054-68076 GCCGGGGGAGGTGGCGGGCTGGG + Intergenic
1185507946 X:643431-643453 GCCTGGGGACCTGGTGACCCGGG + Intronic
1185888882 X:3806787-3806809 GCCTGCGGAGGAGGGAGCCCTGG + Intergenic
1187067342 X:15854379-15854401 GCCGGGGGCGGTGGCGGCCGAGG - Intronic
1189310403 X:40013964-40013986 GCCCGGGGAGGGGGCGCTCCGGG + Intergenic
1189658873 X:43277539-43277561 CCTTGGGGAGGAGGCTGCCCTGG - Intergenic
1189875640 X:45433530-45433552 GTCTGGGGTGGTGGTGGCCATGG - Intergenic
1190596927 X:52060449-52060471 GCCAGGGGTGGTGGAGTCCCAGG + Intergenic
1190602653 X:52108446-52108468 GCCTGGGGTGGTGGTGGCTATGG - Intergenic
1190611897 X:52193624-52193646 GCCAGGGGTGGTGGAGTCCCAGG - Intergenic
1191972624 X:66833482-66833504 GCCTGGGGACTTGGCTGCCCTGG + Intergenic
1192858453 X:75039666-75039688 GCCTGGGGTGGTGATGGCCATGG - Intergenic
1193366208 X:80637193-80637215 GCCTGGGTTGGTGGTGGCCATGG - Intergenic
1193441090 X:81539687-81539709 GCCTGGAGTGGTGGCAGCCATGG + Intergenic
1194393153 X:93346352-93346374 GCCTGAGGTGGCGGCGGCCATGG - Intergenic
1194977806 X:100410897-100410919 GTCCGGGGGGGTGGCGGCCGTGG - Intergenic
1195060748 X:101191625-101191647 GCCCGGGGAGGCCGCTGCCCGGG + Intergenic
1195849104 X:109264076-109264098 GCCTGAGGTGGTGGCAGCCATGG - Intergenic
1195894621 X:109733104-109733126 GGATGGGGAGGTTGCGGCCCCGG - Intronic
1196096713 X:111808412-111808434 GCCTGGTGTGGTGGTGGCCATGG - Intronic
1196357250 X:114809265-114809287 GCATGGGGTGGTGGCGGCCATGG - Intronic
1196391650 X:115212893-115212915 GCCTGGGGAGGTTGAGGCTGTGG + Intronic
1196808911 X:119613024-119613046 GCCAGGCGTGGTGGCGGGCCAGG + Intergenic
1197488819 X:127090260-127090282 GCCTGGGGTGGTTGGGGCCACGG - Intergenic
1197776741 X:130123043-130123065 GCATGGGGAGATGGCTGCCAAGG + Intergenic
1198312937 X:135438035-135438057 GCCAGGCGAGGTGGCTGACCTGG + Intergenic
1199169360 X:144717937-144717959 GCCAGGGGAGGTGGAGACTCTGG - Intergenic
1199568731 X:149246220-149246242 GCCTGAGGCAGTGGTGGCCCAGG - Intergenic
1199609589 X:149601180-149601202 GCCTGGCCAAGTGGCGCCCCCGG - Intronic
1199629527 X:149768174-149768196 GCCTGGCCAAGTGGCGCCCCCGG + Intergenic
1200057287 X:153468301-153468323 GGCTGAGGAGGGGGAGGCCCGGG + Intronic
1201063581 Y:10069264-10069286 GCCTGGGGAGGTGTCACCCAGGG - Intergenic