ID: 1092063602

View in Genome Browser
Species Human (GRCh38)
Location 12:5571131-5571153
Sequence ACACCTCCAAGCAGACCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092063599_1092063602 11 Left 1092063599 12:5571097-5571119 CCATCCACAGAAGCTGCTGCTGG 0: 1
1: 0
2: 3
3: 73
4: 750
Right 1092063602 12:5571131-5571153 ACACCTCCAAGCAGACCCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 106
1092063601_1092063602 7 Left 1092063601 12:5571101-5571123 CCACAGAAGCTGCTGCTGGATGC 0: 1
1: 0
2: 1
3: 33
4: 303
Right 1092063602 12:5571131-5571153 ACACCTCCAAGCAGACCCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 106
1092063598_1092063602 22 Left 1092063598 12:5571086-5571108 CCTGGCAGAAGCCATCCACAGAA 0: 1
1: 0
2: 1
3: 22
4: 262
Right 1092063602 12:5571131-5571153 ACACCTCCAAGCAGACCCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092063602 Original CRISPR ACACCTCCAAGCAGACCCGC TGG Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
903754407 1:25650992-25651014 ACTCCTCCAAGGAGACCTGGAGG + Intronic
903936319 1:26897561-26897583 TCAACTCCAAAAAGACCCGCAGG + Exonic
903971027 1:27118916-27118938 ACATCTCCAAGCACAGCCACAGG + Intronic
905665645 1:39761546-39761568 ACACCTTCATTCAGACCCCCAGG + Intronic
922972958 1:229758532-229758554 AAACCTCAAAGCAGAGCCTCGGG - Intergenic
1062804526 10:407443-407465 ACACCCCGAAGCAGAACTGCTGG + Intronic
1063157612 10:3394920-3394942 ACCCCTACAAGCATACCGGCAGG + Intergenic
1066101498 10:32122284-32122306 ACAGCTCAGAGGAGACCCGCAGG + Intergenic
1068910855 10:62376589-62376611 GGACCTCCATGCAGACTCGCTGG + Exonic
1069835242 10:71304051-71304073 CCACCTGCATGCAGACCCCCAGG + Intergenic
1073432159 10:103493884-103493906 CCCGCTCCACGCAGACCCGCGGG + Intergenic
1074853190 10:117455137-117455159 ACACCTCCAGGCAGCTCCACAGG - Intergenic
1077484353 11:2832021-2832043 CCACCTCCAGGCAGCCCTGCAGG + Intronic
1084089225 11:66869338-66869360 ACACCTCCAAGCAGAAGCAGCGG - Intronic
1084318430 11:68359376-68359398 AAATCTCAAACCAGACCCGCTGG - Intronic
1084740929 11:71139146-71139168 CCACCTCCCAGCAGACGCTCAGG - Intronic
1084759477 11:71260176-71260198 CTCCCTCCAAGCAGACCTGCTGG - Intergenic
1091712243 12:2750264-2750286 CCACCTCCATGGAGACCAGCAGG - Intergenic
1092063602 12:5571131-5571153 ACACCTCCAAGCAGACCCGCTGG + Intronic
1093465095 12:19440305-19440327 ACATCTCCAAGCTGCCCCGCCGG - Exonic
1096983931 12:55744280-55744302 ACACCTCCTGGCAGCCCAGCTGG + Intronic
1112220312 13:97482819-97482841 ACAGCTCCAAACACACCCTCTGG - Intergenic
1113696470 13:112349624-112349646 ACACCTCCCAGCAGAGCTGTGGG - Intergenic
1118404766 14:65412562-65412584 CCACCGCCTAGCAGAGCCGCGGG - Intronic
1119207733 14:72807110-72807132 AAACCTCAAAGCAGGCCCACAGG + Intronic
1121444842 14:93972336-93972358 ACACCTCCGAGCACTCCAGCTGG - Intronic
1125717083 15:41825511-41825533 TCCACTCCAAGCAGCCCCGCAGG - Exonic
1130042050 15:80413375-80413397 ACACTTCCAACCAGACCACCTGG + Intronic
1130258326 15:82336165-82336187 ACACCTGCAGGCAGCCCCCCTGG - Intergenic
1130924713 15:88376212-88376234 TCACCTCCAAGAAGTCCCCCCGG - Intergenic
1143668982 17:8383507-8383529 AGACCGCCCAGGAGACCCGCTGG + Intergenic
1144581243 17:16460650-16460672 ACACCTCCGAGGAGAACCACAGG - Intronic
1146903365 17:36602158-36602180 TCACCTCCATGCAGACACCCTGG - Exonic
1147158391 17:38557023-38557045 AGATCTCCAAGCAGACTGGCAGG - Intronic
1152599099 17:81252557-81252579 AAACCTCCATCCAGACACGCGGG - Exonic
1152797436 17:82315163-82315185 CCAGCTCCAAGCAGACACACAGG - Exonic
1154132013 18:11745536-11745558 TCCCCTCCAACCTGACCCGCTGG + Intronic
1157444710 18:47736131-47736153 ACACCTACAAGCAGAGTCACTGG - Intergenic
1160720452 19:594818-594840 ACCCCTCCACGCAGACCAGAGGG - Intronic
1160807001 19:996317-996339 CCAGCTCCCAGCCGACCCGCCGG - Intronic
1161254078 19:3296656-3296678 ACACTCCCAAGCAGGCCCTCGGG - Intronic
1163338012 19:16686323-16686345 TCACCCTCCAGCAGACCCGCTGG + Exonic
1165586024 19:36916311-36916333 ACACCTCCCAGCAGGCCCCGCGG - Intronic
1167340542 19:48913328-48913350 ACAACTCCCAGCAGACCCTGGGG - Intronic
1167710118 19:51105233-51105255 ACACCTCTCAGGAGACCAGCTGG + Intronic
1168348139 19:55660689-55660711 CCCCCTCCAAGCACACACGCAGG - Intronic
1168636777 19:58002829-58002851 ACAGCTCCCAGCAGACCCCGCGG - Exonic
925002836 2:420059-420081 ACGCCTCCAGGCAAACCCACGGG - Intergenic
925256753 2:2496355-2496377 ACACGTCCAAGCAGAGCAGGTGG + Intergenic
929804944 2:45136709-45136731 ACATCTCCAGGCAGACCCTATGG - Intergenic
930271387 2:49261701-49261723 AGACCTCCAAGCAAACCCTCAGG - Intergenic
932126339 2:69148438-69148460 ATAGCTCCCAGCAGACCAGCGGG - Intronic
938722052 2:134075971-134075993 ACAGCTCAAAGGAGACCCTCAGG + Intergenic
940396235 2:153195845-153195867 ACAGCTCAGAGGAGACCCGCAGG + Intergenic
942144909 2:173017618-173017640 GCACCTCCAAGCAAACCATCTGG - Intronic
948290292 2:236819385-236819407 ACACCTCCAAGATGCCCAGCAGG - Intergenic
1169073723 20:2749471-2749493 ACAACTCCAAGCATGGCCGCAGG + Exonic
1170501081 20:16975452-16975474 ACAACTCAGAGGAGACCCGCAGG - Intergenic
1174527293 20:51183675-51183697 ACACCTCCTAGCAGAGGCCCAGG + Intergenic
1175923451 20:62460823-62460845 ACTCCTCAAAGCAGGCCCGGAGG - Intergenic
1182620718 22:31617057-31617079 AGACCACCAAGCAGAACCTCTGG + Exonic
1183696983 22:39429006-39429028 ACTCCTCCAGGCAGCCCGGCAGG - Intronic
1184263112 22:43330843-43330865 TCAAGTCCAAGCAGACCAGCAGG - Intronic
1184424975 22:44404007-44404029 AGACCTCCAAGCACACCCTCGGG + Intergenic
1185181440 22:49365709-49365731 ACCTCTGCAAGCAGCCCCGCAGG - Intergenic
954871375 3:53769815-53769837 CCACCTCCAAGGAGAGCCACTGG + Intronic
960011951 3:112843055-112843077 ACAACTCCTTGGAGACCCGCTGG - Intronic
967867066 3:194198905-194198927 CAACCTCCCAGCAGACCCCCTGG + Intergenic
967975619 3:195032958-195032980 GGACCTCCAAGCACACCTGCAGG + Intergenic
968345138 3:197997560-197997582 ACACTTGCACGCAGAGCCGCTGG + Intronic
975883531 4:78939111-78939133 ACACCTACGAGCAGATCCCCGGG - Exonic
976192045 4:82496824-82496846 ACACCTCCAAGTAGAATCGAAGG - Intronic
978374142 4:108057549-108057571 ACAGCTCCTGGCAGACCCTCAGG + Intronic
979242104 4:118456438-118456460 ACACCTCAGAGCAGAACTGCCGG + Intergenic
981785192 4:148469538-148469560 TCACTTCCAAGTAGACCCGCTGG - Intergenic
985634609 5:1029964-1029986 TCACCTCCCATCAGACCAGCAGG - Intronic
986258305 5:6120676-6120698 ACACCTCCAAGCTGGCCATCAGG - Intergenic
987668174 5:20972622-20972644 ACCCCTCCCAGCTGAGCCGCTGG - Intergenic
994888463 5:105598177-105598199 ACACCTCCATGCACACCAACTGG - Intergenic
995017769 5:107331115-107331137 ACAGCTCCAAACAGAGCCACTGG + Intergenic
996101851 5:119452530-119452552 ACACGAACAAGCAGAGCCGCTGG - Intronic
996443271 5:123514563-123514585 ACACCTCCAACAAAACCCACAGG - Intronic
999286341 5:150396495-150396517 ACACCACCAAGGAGAGCAGCAGG + Exonic
1001945359 5:175773523-175773545 ACATCTCCAGGCGGACGCGCAGG + Intergenic
1007290702 6:40784049-40784071 ACCCCTCCAAGAAGACCTTCAGG - Intergenic
1010543561 6:77122921-77122943 CCACCTCCAAGCAGATCTCCAGG - Intergenic
1013709378 6:112879795-112879817 ACAGCTCAGAGGAGACCCGCAGG + Intergenic
1016458527 6:144257696-144257718 ACACCTCCCAACAGATCCTCTGG - Intergenic
1016936388 6:149451587-149451609 ATTCCTCCAAGCAGGCCCCCAGG + Intronic
1019261520 7:84493-84515 ACACCTCCAAGCAGGCCCTGAGG + Intergenic
1031638140 7:124127065-124127087 ACTGCACCAAGCAGACCCACAGG + Intergenic
1035621831 8:1041274-1041296 GCACCTCCAAGCTAACTCGCTGG - Intergenic
1036702499 8:11022413-11022435 ACATGTCCAAGCAGTCCCCCTGG + Intronic
1040826244 8:51623612-51623634 ACAGCACCCAGCAGACCCGTGGG + Intronic
1041140082 8:54808295-54808317 ACACCTTCGTGCAGAGCCGCGGG - Intergenic
1049733599 8:144191892-144191914 ACCCCTCCAATCAGACTCCCCGG + Intronic
1051149185 9:14062064-14062086 ACACGTCCAAGCAGGCTGGCGGG - Intergenic
1051186544 9:14466683-14466705 ACACCACAAAGCAGACCCTGGGG - Intergenic
1054160536 9:61669820-61669842 ACACCTCCAGGCAACCCCTCAGG + Intergenic
1057106385 9:92421553-92421575 GCATTTCCAAGCAGACCCACTGG - Intronic
1057374789 9:94510745-94510767 ACACTTCCAGGCAGAGCCACTGG + Intergenic
1058828226 9:108793791-108793813 ACACATCCAAGCACCCCAGCTGG - Intergenic
1061135275 9:128730075-128730097 ACACCTGAAAACAGGCCCGCGGG + Exonic
1062130386 9:134889599-134889621 ACACCTCCCAGAGGCCCCGCAGG - Intergenic
1062502650 9:136857983-136858005 GCTCCTCCAGGTAGACCCGCAGG - Exonic
1062624645 9:137437238-137437260 CCTCCTCCAAGCAGCCCTGCAGG + Exonic
1187095216 X:16140808-16140830 TCACCTCCAAACAGACCCCGAGG - Intronic
1187930833 X:24292202-24292224 ATCCCTCCAAGCAGAACCGGAGG - Intergenic
1196812062 X:119636699-119636721 ACAGCTCCAAGCAGCTGCGCTGG - Intronic
1197446159 X:126553527-126553549 ACACCTCCAAAAAGCCCCTCAGG - Intergenic
1199861069 X:151800986-151801008 ACAGCTCAGAGGAGACCCGCAGG + Intergenic