ID: 1092064104

View in Genome Browser
Species Human (GRCh38)
Location 12:5575248-5575270
Sequence CCAGACCATAGCCCCCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092064100_1092064104 24 Left 1092064100 12:5575201-5575223 CCAAATAACCTGCTATTTCCTAT 0: 1
1: 0
2: 2
3: 19
4: 222
Right 1092064104 12:5575248-5575270 CCAGACCATAGCCCCCTTGATGG 0: 1
1: 0
2: 1
3: 8
4: 134
1092064101_1092064104 16 Left 1092064101 12:5575209-5575231 CCTGCTATTTCCTATCTGTTCTG 0: 1
1: 0
2: 0
3: 19
4: 269
Right 1092064104 12:5575248-5575270 CCAGACCATAGCCCCCTTGATGG 0: 1
1: 0
2: 1
3: 8
4: 134
1092064102_1092064104 6 Left 1092064102 12:5575219-5575241 CCTATCTGTTCTGCTTATTTTCT 0: 1
1: 0
2: 1
3: 63
4: 582
Right 1092064104 12:5575248-5575270 CCAGACCATAGCCCCCTTGATGG 0: 1
1: 0
2: 1
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092064104 Original CRISPR CCAGACCATAGCCCCCTTGA TGG Intronic
901422191 1:9158637-9158659 CCAGCTCAGAGTCCCCTTGAAGG + Intergenic
901862793 1:12085637-12085659 CCAGACCAGAGCTCCCTTTCTGG + Intronic
904005643 1:27361795-27361817 CCACGCCAGAGCCCCCTGGAGGG - Exonic
907409659 1:54275096-54275118 CCAGACTATGAGCCCCTTGAGGG + Intronic
907835624 1:58105980-58106002 CCAGAACATAAGCTCCTTGAGGG - Intronic
910702281 1:90089296-90089318 TAAGACCATAAACCCCTTGAAGG - Intergenic
913374289 1:118133467-118133489 CCAGATCTTAGCCACCATGATGG - Intronic
915531433 1:156504552-156504574 CCAGATCCTGGGCCCCTTGAGGG + Intergenic
917141102 1:171836847-171836869 CCATACCATATCACCCTTAAAGG + Intergenic
917438992 1:175049679-175049701 CCAGAACATAAGCCCCATGAGGG - Intergenic
922360627 1:224818459-224818481 CCAGACCTCATCCCCCATGAAGG + Intergenic
923017610 1:230139077-230139099 TCACACCATAACCCCCGTGAGGG - Intronic
1065017913 10:21478590-21478612 CGAGACCATAGACCCGCTGAGGG - Intergenic
1067733786 10:48833345-48833367 CCAGCCAATAGCCCCCCTTAAGG - Intronic
1068173572 10:53426700-53426722 ACAGACAAGAGCCACCTTGACGG + Intergenic
1069908478 10:71746105-71746127 CCAGACCGTAGGCTCCTGGAGGG - Intronic
1074163521 10:110854917-110854939 CCAGACCGTAAGCTCCTTGAGGG + Intergenic
1078614045 11:12848168-12848190 CTAGACCATAAACTCCTTGAGGG + Intronic
1081767401 11:45621243-45621265 TCAGGCCATACCCCACTTGAAGG + Intergenic
1081780512 11:45707804-45707826 CCAGACTGTAAGCCCCTTGAAGG + Intergenic
1084518146 11:69647391-69647413 CCACACCACAGCCGCCCTGAAGG + Intronic
1085661070 11:78367292-78367314 CCAGACCATATGCCCTTCGAAGG - Intronic
1089754526 11:120676795-120676817 CCAAACCATAGCACCATGGAAGG + Intronic
1090641800 11:128735854-128735876 CCAGCTCATAGGACCCTTGAAGG - Intronic
1092064104 12:5575248-5575270 CCAGACCATAGCCCCCTTGATGG + Intronic
1092102007 12:5891300-5891322 CTAGACCACAGGCCCCTAGAAGG + Intronic
1092106076 12:5922546-5922568 CCAGACCAGAGGCTCCTTGGTGG + Intronic
1094527042 12:31238245-31238267 CCAGACCATCAGCCCTTTGACGG - Intergenic
1095785614 12:46106022-46106044 CCAGACCATAAACATCTTGAAGG - Intergenic
1096217741 12:49807828-49807850 CCACACCCTAGCCCCTCTGATGG - Intronic
1096996168 12:55839607-55839629 CCAGAGCATGGCCCACTTCATGG + Exonic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1105022501 12:132826587-132826609 CCAGAACAGAGACCCCATGACGG + Intronic
1106553917 13:30794037-30794059 TCTGGCCATAGTCCCCTTGAGGG + Intergenic
1111889003 13:94058519-94058541 CCACACCATAGCCCCCTAGGTGG + Intronic
1114716359 14:24829796-24829818 CTAGACCGTAGGCCCCTTGCCGG - Intronic
1114966807 14:27971797-27971819 CAACACCATAGTCTCCTTGAAGG + Intergenic
1118000915 14:61522739-61522761 CCAGACATTAACCCCCTTGTGGG + Intronic
1119900717 14:78257350-78257372 CTAGACCATAAGCCCCTTAAGGG - Intronic
1120916489 14:89715128-89715150 TCAGACCATAGCACCCAAGATGG + Intergenic
1122872121 14:104643559-104643581 CCAGAACATATTCCCCTTTATGG + Intergenic
1123977657 15:25568251-25568273 CCAGGGCATAGCCTGCTTGAGGG + Intergenic
1124068512 15:26369126-26369148 CCCAACCAATGCCCCCTTGAAGG - Intergenic
1124989774 15:34660150-34660172 CCAGTCCATGGCCCTCTTCAGGG - Intergenic
1129600282 15:76994730-76994752 CCAGACTATGGGCTCCTTGAGGG + Intronic
1131045197 15:89308971-89308993 CCAGATGACAGCCCACTTGATGG - Intronic
1135130107 16:19846527-19846549 CCAGAGCAAAGTCTCCTTGAAGG - Intronic
1135489545 16:22897268-22897290 CCAAACCAGAGGCCCCATGAGGG + Intronic
1135502820 16:23012054-23012076 CCAGACCATAAGCTCCATGAGGG + Intergenic
1135876335 16:26203817-26203839 CCAAAGCAGAGCCCCATTGAAGG - Intergenic
1138100166 16:54245839-54245861 CTAGGCCATTGGCCCCTTGAGGG - Intronic
1139199448 16:64958109-64958131 CCAGACAATAACCTCCTTGAGGG + Intronic
1144573419 17:16415056-16415078 CCAGACCAGGGCCCCGTTGGTGG + Intergenic
1146059099 17:29595215-29595237 CCAGAACAGAGACTCCTTGAGGG - Intronic
1146502044 17:33372722-33372744 GCAGCCCATAGCCCCCTGGGAGG + Intronic
1148348644 17:46922573-46922595 CCAGACCAGAACCTCTTTGAGGG + Intergenic
1151013224 17:70525639-70525661 CCTGACCAGAGCCCCTCTGATGG - Intergenic
1151084510 17:71365106-71365128 CCTGCCCTTAGCCCCCCTGATGG + Intergenic
1152226726 17:79096229-79096251 CCAGGGCCTACCCCCCTTGATGG - Intronic
1155147870 18:23098766-23098788 CCAGACTATAAGCTCCTTGAGGG - Intergenic
1156996959 18:43480230-43480252 CTAGACACTAGCCTCCTTGAGGG + Intergenic
1157788382 18:50507293-50507315 CCAGCCCACAGGCCACTTGAGGG + Intergenic
1160750163 19:730195-730217 CCAGCCCACAGCCGCCTGGAGGG - Intronic
1162795169 19:13083268-13083290 CCAGACCCCAGGCCCCTTGGGGG - Intronic
1168040938 19:53758097-53758119 CCAGAACATAACCCCCTAAAAGG - Intergenic
926035955 2:9635876-9635898 CCAGACCATGAGCCTCTTGAGGG + Intergenic
927494180 2:23541449-23541471 CCAGACCATGGGCTCCTTGAGGG + Intronic
937040754 2:118818837-118818859 CCAGACGGTTGCCCCCTTGAGGG - Intergenic
937248669 2:120510173-120510195 CCAGCCCACAGCCCCCATGGAGG - Intergenic
939628928 2:144512050-144512072 TCAGACAATTGCCCCCTTGTGGG + Intronic
940391087 2:153133322-153133344 CCAGTGCATAGGCCCCTTGGAGG - Intergenic
941133657 2:161685932-161685954 CCAGACTATGACCTCCTTGAAGG - Intronic
942188457 2:173447129-173447151 ACAGACTATAAGCCCCTTGAAGG - Intergenic
947590825 2:231384183-231384205 CCAGGCCAGAGCCCCCTGGGTGG - Intergenic
948523996 2:238559316-238559338 CCAGACCAGAGCCCCCAAGACGG + Intergenic
1169393402 20:5208758-5208780 CCAGAGCAGCACCCCCTTGATGG + Intergenic
1175737936 20:61400064-61400086 CCAGGCCACAGCCCACTTGTGGG - Intronic
1176034212 20:63028515-63028537 CCAGAGCAAAGCCCCCATGGGGG - Intergenic
1180119881 21:45739253-45739275 CCTGTCCATGGCCCCCTGGATGG + Intronic
1181928021 22:26375913-26375935 CTAAACCATAACCTCCTTGAGGG - Intronic
1182786871 22:32915370-32915392 CCAGAATATAAGCCCCTTGAGGG - Intronic
1182821767 22:33222711-33222733 CAAGACCATGATCCCCTTGAAGG - Intronic
1184402944 22:44284486-44284508 CCATCCCAGAGCCCCCTTGCTGG - Intronic
1184676119 22:46044399-46044421 GCAGACCATGGCCCCAGTGACGG - Intergenic
950106481 3:10392119-10392141 CCTGACCATGAGCCCCTTGAAGG + Intronic
954278991 3:49562370-49562392 CCACACCATGGGCCCCTTTAGGG - Intronic
954431514 3:50473243-50473265 CCTCACCATAACCCCCATGAGGG - Intronic
955329166 3:58032702-58032724 CCAGACCACATCCCACTAGATGG - Intronic
955528055 3:59841113-59841135 AGAGTCCATAGCCCCTTTGATGG + Intronic
960327690 3:116317288-116317310 CCAGACCAGAACCCACTGGAAGG + Intronic
964522732 3:157585356-157585378 CCTGACCATGGCCTCCTTGGAGG + Intronic
964734934 3:159907304-159907326 CCAGACTATAAACCCCCTGAGGG + Intergenic
967951795 3:194847054-194847076 CCAGAGCACAGCCCCGCTGAGGG + Intergenic
968812008 4:2804412-2804434 CCAGGCCACAGCCCCCTTTTGGG - Intronic
968870086 4:3237485-3237507 CTAGACCACAAGCCCCTTGAAGG - Intronic
968967383 4:3775996-3776018 CCGGATCAGAGCCACCTTGAGGG - Intergenic
977214645 4:94266054-94266076 CCATCCCATAGCACCCTAGAAGG - Intronic
980863829 4:138530172-138530194 CCAGACCTTAGGCCCCTGGGTGG - Intergenic
981951804 4:150418773-150418795 CCAGAGCAGAGGCCTCTTGAAGG + Intronic
992503894 5:77366885-77366907 CTGGACCAAAGCGCCCTTGATGG - Intronic
996285389 5:121785117-121785139 CAAGACCATTACCTCCTTGAGGG - Intergenic
998392419 5:141795761-141795783 CCAGCCCATGGCCCCCTAGCAGG + Intergenic
999936004 5:156486445-156486467 CCAGTCCCAAGACCCCTTGAAGG - Intronic
999992368 5:157061395-157061417 CCAGACCATAAACTCCTTTAAGG + Intergenic
1003004604 6:2369289-2369311 CCAGACTATGGGCCCCCTGATGG + Intergenic
1003464954 6:6370128-6370150 CCAGACTATAAGCTCCTTGAGGG - Intergenic
1005206395 6:23410206-23410228 CTAGACTATAGGCTCCTTGAAGG + Intergenic
1006841922 6:37033958-37033980 CCAGACCACAAGCCCCTCGAGGG + Intergenic
1006933562 6:37701994-37702016 CTAGACTATAGCCTCCATGAAGG - Intergenic
1007582973 6:42970149-42970171 ACAGACCATACACACCTTGAGGG + Intronic
1013408922 6:109866998-109867020 TCAGACCACAGCCTCCTTGGGGG + Intergenic
1013773615 6:113653740-113653762 CTAGACCATAAACCCCTTGAAGG - Intergenic
1017247718 6:152245241-152245263 CCAGACCATCAGCTCCTTGAAGG - Intronic
1017752370 6:157499944-157499966 CTAGAACATAAGCCCCTTGAAGG - Intronic
1022325696 7:29330011-29330033 CCAGACTATAAACTCCTTGAAGG + Intronic
1023202889 7:37718148-37718170 CTAGACTATAGTCCCCATGAGGG - Intronic
1026252572 7:68683791-68683813 CCACTCCATAGCCCCCTTGAAGG + Intergenic
1032291885 7:130596393-130596415 CCAAATAATAGCCACCTTGAAGG - Intronic
1034302715 7:150030700-150030722 CCAAACTCTAGCACCCTTGAAGG + Intergenic
1034803344 7:154066598-154066620 CCAAACTCTAGCACCCTTGAAGG - Intronic
1036558795 8:9884148-9884170 ACAAACCACAGCCCCCGTGACGG - Intergenic
1037948435 8:23003818-23003840 CCAGACCCCAGTCCCCTTTATGG - Intronic
1042145159 8:65720725-65720747 CCAGAACATAAGCTCCTTGAGGG - Intronic
1045542590 8:103100979-103101001 CTAGACTATAGACTCCTTGATGG - Intergenic
1046145158 8:110148667-110148689 ACAGACCATAAACCTCTTGAAGG - Intergenic
1048016878 8:130505574-130505596 CCAGAACATATGCTCCTTGAGGG - Intergenic
1049228317 8:141468253-141468275 TCAGACTATAGCCTCCTGGAGGG + Intergenic
1049958148 9:712143-712165 GCAGACCATAGAATCCTTGAAGG + Exonic
1053478293 9:38397510-38397532 CCCAACCACAGCCCCCTTGGTGG + Exonic
1054194398 9:62015893-62015915 CCTGATCCTAGGCCCCTTGAGGG + Intergenic
1054644009 9:67572797-67572819 CCTGATCCTAGGCCCCTTGAGGG - Intergenic
1055335321 9:75227642-75227664 CCAAACCATATCAGCCTTGAAGG + Intergenic
1056268013 9:84919013-84919035 CCAGACCATAGAGAGCTTGAAGG - Intronic
1060154233 9:121308139-121308161 CCAACCCACAGCTCCCTTGAAGG + Intronic
1061012054 9:127961566-127961588 CCAGAGTATAAGCCCCTTGAAGG - Intronic
1061313292 9:129777915-129777937 CCAGAACATAGCCCACATGAGGG - Intergenic
1062045987 9:134424787-134424809 CCTGACCTGAGCCCCCTGGAGGG - Intronic
1062721366 9:138045972-138045994 CCAGAGCACAGCCCTCGTGATGG + Intronic
1188507516 X:30898573-30898595 CCAAACCAAACCTCCCTTGATGG - Intronic
1189647525 X:43149708-43149730 ACAGACCACATCCCCCTTGAGGG + Intergenic
1190254393 X:48751799-48751821 CCAAACCATGGCCACCTTCAGGG - Intergenic
1192713382 X:73615565-73615587 CCTGACCATAGCCTCCTAGGAGG + Intronic
1194672260 X:96748625-96748647 CCAGAACATAAGCTCCTTGATGG - Intronic
1196375126 X:115025346-115025368 CCAAACCCTAGCCTCCATGAGGG + Intergenic