ID: 1092066784

View in Genome Browser
Species Human (GRCh38)
Location 12:5597008-5597030
Sequence CCAGCTAGTTGGTCAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092066784 Original CRISPR CCAGCTAGTTGGTCAAAAGC TGG Intronic
907661575 1:56397808-56397830 CCAGCTAGATGGTCATCATCTGG + Intergenic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
913489655 1:119367027-119367049 CCTGCTGGTGGGTCCAAAGCTGG + Intergenic
916506776 1:165435428-165435450 CCCGCTAGCTGGTAAAGAGCAGG + Intronic
1070268693 10:74930610-74930632 CAAGAAAGTTGGTTAAAAGCAGG + Intronic
1075666982 10:124238421-124238443 CCAGAGAGTAGGTCCAAAGCAGG - Intergenic
1078567485 11:12429093-12429115 CCAGCTACTTGGGAAGAAGCTGG - Intronic
1078878031 11:15417777-15417799 CCAGATATTTGGTCAACATCAGG + Intergenic
1084244966 11:67850802-67850824 CCAGCCAGTTAGGCAAAAACAGG - Intergenic
1084902006 11:72316641-72316663 CCAGATAGTTTGTCAGCAGCTGG - Intronic
1092066784 12:5597008-5597030 CCAGCTAGTTGGTCAAAAGCTGG + Intronic
1093502990 12:19833664-19833686 CCAGATATTTGGTCAAACACTGG + Intergenic
1099199534 12:79659180-79659202 CCAGCTACTTGGGCTAAGGCAGG + Intronic
1115536204 14:34375841-34375863 ACAGATAGTTGGTCAAGAGATGG - Intronic
1127392480 15:58517919-58517941 ACAGCTAGTTGGTGCAAAGTGGG + Intronic
1128508768 15:68300668-68300690 CCAACTAAGTGGTCAAAAGGTGG - Intronic
1128989197 15:72244662-72244684 CAAGACAGTTGGTCAAATGCTGG + Intronic
1133221548 16:4321124-4321146 CCAGATAGCTGGGCAAGAGCAGG - Intronic
1137603768 16:49773923-49773945 CCAGCCAGTTGGTAAATGGCTGG - Intronic
1142202577 16:88768171-88768193 CCAGCTGGTGGGGCAAGAGCTGG + Intronic
1144604158 17:16649621-16649643 CAAGATAGTAGGTCAAAAACAGG + Intronic
1144946236 17:18971009-18971031 CCACCGATCTGGTCAAAAGCTGG - Exonic
1146630612 17:34466797-34466819 TCACCTAGTGGGTCAAAGGCAGG + Intergenic
1151144427 17:72027638-72027660 CCAGCCAGATGGTCAATAGCTGG - Intergenic
1156746128 18:40393454-40393476 GTAGCCAGTTGGTCAAAAGCTGG - Intergenic
1161311153 19:3594894-3594916 CCAGCAAGTAGGTCAAATTCAGG + Exonic
1167867915 19:52343287-52343309 CCAGCTACTTGGGCTAAGGCAGG + Intronic
928284730 2:29979913-29979935 CCAGCTAGTGGGGCCACAGCTGG - Intergenic
932262298 2:70337035-70337057 CCAGGAAGCTGGTGAAAAGCTGG - Intergenic
932353241 2:71048450-71048472 CCAGCTGGTTAGGCAAAACCAGG + Intergenic
933209146 2:79546027-79546049 CCAGCTAGTTGGGGAAGAGGTGG + Intronic
934656702 2:96120132-96120154 GCAGCTGCTTGGTCAAAGGCAGG - Intergenic
940076400 2:149746832-149746854 CCACCTAGTTAGGCAAAGGCAGG - Intergenic
940874153 2:158883750-158883772 CCAGCTGGTTAGGCAAAAACAGG + Intergenic
942383381 2:175416971-175416993 CCAGCACGTTGGTCAAACCCTGG + Intergenic
946189350 2:217999884-217999906 CCAGCTAAGTGGTCTCAAGCTGG - Intronic
948712044 2:239831330-239831352 GCAGCCAGCTGGTCTAAAGCTGG + Intergenic
1170827348 20:19808404-19808426 CCAGCTAGATGGTCAAAGCAGGG - Intergenic
1171086960 20:22246579-22246601 CCAGGAAGTTTGTTAAAAGCAGG - Intergenic
1173594469 20:44249694-44249716 CCAGAGACTTGGTCAAAAGTGGG - Intronic
1182325709 22:29511215-29511237 GCAGCTGGTTGGTCAACAGCTGG + Exonic
950119141 3:10470351-10470373 CCAGCTAGGTGATCTTAAGCAGG - Intronic
950974234 3:17223790-17223812 CCAGCTACTTGGGAAGAAGCAGG + Intronic
952144801 3:30520245-30520267 CCTGCAAGTAGGTAAAAAGCAGG - Intergenic
952620617 3:35336111-35336133 CCAGCTAGTGGGTGAAACTCAGG + Intergenic
953926548 3:46985571-46985593 ACAGCTAGTTGGGCATAAGTTGG + Intronic
954292404 3:49656532-49656554 CCAGCTAGTGGGGCAGGAGCTGG - Exonic
955748882 3:62167882-62167904 AAAGCTATTTGGTCCAAAGCAGG - Intronic
960482757 3:118213359-118213381 CCATCTAGTAGGTCAAAGCCAGG + Intergenic
963074694 3:141334855-141334877 CTAGCTAATTGTTCAAAATCAGG - Intronic
964450379 3:156806905-156806927 ACAGCTGGATGGTCAAAGGCAGG + Intergenic
968004048 3:195227164-195227186 CCAGCTTCATGTTCAAAAGCAGG - Intronic
975159667 4:71111026-71111048 CCAGCCACTTGTTCAAAATCTGG + Intergenic
975912870 4:79289622-79289644 ACAGCTAGTTGGTGGGAAGCTGG + Intronic
981817323 4:148845826-148845848 CCAGATAGTTGGTCTTATGCTGG + Intergenic
983876119 4:172876354-172876376 CCAACTAGTTATCCAAAAGCAGG - Intronic
992005874 5:72476788-72476810 CCAGCCACTTGGTGAGAAGCTGG + Intronic
994508803 5:100677038-100677060 ACATTTATTTGGTCAAAAGCTGG - Intergenic
999872953 5:155771533-155771555 CCAGCTAGTTAGGCTGAAGCAGG - Intergenic
1003184329 6:3817609-3817631 CCAGCTACTTGGACTGAAGCAGG + Intergenic
1010025179 6:71206845-71206867 ACAGCTAGTTGGTGAAAAACTGG + Intergenic
1017545453 6:155446585-155446607 ACAGCTTGATGGTCAAAAGATGG - Intronic
1020241484 7:6398468-6398490 CACGCTACCTGGTCAAAAGCAGG - Intronic
1020506965 7:9003017-9003039 AAAGCTATCTGGTCAAAAGCTGG - Intergenic
1023095358 7:36654726-36654748 CCAGCTAATTCCTCATAAGCAGG - Intronic
1023779965 7:43646490-43646512 CCACATAGCTGGTCAAGAGCTGG + Intronic
1024009612 7:45256681-45256703 CCAGATGTTTGGTCAAATGCCGG - Intergenic
1024812295 7:53226336-53226358 TCAGCCAATTGGTCATAAGCAGG + Intergenic
1025267509 7:57476072-57476094 CCAGCTACTTGGGCTAAGGCAGG - Intergenic
1028331485 7:89600126-89600148 CCATCTTAGTGGTCAAAAGCAGG + Intergenic
1034343401 7:150371811-150371833 CCAGCTAGTTGCCCACAAGCGGG + Exonic
1034391017 7:150787786-150787808 CCAGCTATATGGTCAAAAAGAGG - Intergenic
1034562317 7:151888929-151888951 TCAGCTGTTTGGTCAAATGCCGG + Intergenic
1041008002 8:53514671-53514693 ACAGCTAGCTGGTCTAAGGCCGG + Intergenic
1045242527 8:100415119-100415141 CCAGCTAATTACTCACAAGCTGG - Intergenic
1047432599 8:124805652-124805674 TCAGATAGCTGGTCAAAAGGTGG + Intergenic
1048095424 8:131287025-131287047 ACAGCTAGTCAGTCAGAAGCAGG - Intergenic
1052990829 9:34518579-34518601 CCAGCTAGTTGGCCTCAAGGAGG + Intronic
1053730182 9:41046484-41046506 CCAGCTAGATTAGCAAAAGCAGG + Intergenic
1054698319 9:68385579-68385601 CCAGCTAGATTAGCAAAAGCAGG - Intronic
1060488470 9:124064699-124064721 CCAGCGAGTTGGTTAAGTGCAGG + Intergenic
1060641258 9:125241131-125241153 CCAGCCAGTTGGGCAGCAGCAGG + Exonic
1191224302 X:58026064-58026086 CAAGCTAGTTTGTCCGAAGCTGG + Intergenic
1197514966 X:127415625-127415647 CCGGCTAGTTGGTTAATAGGTGG + Intergenic
1198208509 X:134493040-134493062 TCAGCTATTTAGTCAAAAGTAGG - Intronic
1200756612 Y:6995995-6996017 CCAAGTGGTTGGTCAATAGCAGG - Intronic