ID: 1092067198

View in Genome Browser
Species Human (GRCh38)
Location 12:5600802-5600824
Sequence TCCTACATCCAGATGAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092067198 Original CRISPR TCCTACATCCAGATGAAGCA TGG (reversed) Intronic
900581568 1:3412313-3412335 TCCTGCATCCCCATGAAGCCGGG - Exonic
901686254 1:10945263-10945285 ACCTGCGTCCAGATGACGCAGGG - Intergenic
902885152 1:19399487-19399509 TCCTACATCAAAATAAACCAAGG + Intronic
905149950 1:35919669-35919691 ACCCAAATCCAGAGGAAGCAAGG + Exonic
905704846 1:40047516-40047538 TCCTACTTGTAGATGAATCATGG + Intronic
909526421 1:76628117-76628139 TCCATTATCCTGATGAAGCATGG - Intronic
910539316 1:88337144-88337166 TTCTACATCAAGATGAAGGAGGG + Intergenic
913273558 1:117117230-117117252 TCCAGCATTCAGATGAAACAGGG + Intronic
914846390 1:151286042-151286064 TCCAAAATCCAGAGAAAGCAGGG - Exonic
916407162 1:164508906-164508928 TCTTAAATTCAGATGAAGCTGGG - Intergenic
917541797 1:175921665-175921687 TCCTACATCCAGACAAGGGAGGG - Intergenic
921340187 1:214126825-214126847 TCATTCATCCAGATCAAGCCTGG - Intergenic
922272446 1:224045979-224046001 TTTTACATTCAGCTGAAGCAAGG - Intergenic
1065090553 10:22229027-22229049 TCCTACATTTTGTTGAAGCATGG - Intergenic
1067718990 10:48712522-48712544 TCCTACATGCCTATGAAACATGG + Intronic
1068937085 10:62646705-62646727 TCAAACATTCAGATGAAGCCTGG + Intronic
1068949668 10:62764508-62764530 TCCTCCACCCTGATCAAGCAAGG + Intergenic
1069461702 10:68600776-68600798 TCTTGCATAAAGATGAAGCAGGG - Intronic
1070279460 10:75038072-75038094 TCTTACCTGCAGATGGAGCAGGG + Exonic
1070485672 10:76928683-76928705 TCCTACATACAGATGATGTAAGG + Intronic
1071370361 10:84945055-84945077 TCATACATACAGATGAGACAAGG + Intergenic
1071611994 10:87040139-87040161 ACCTACAGCCAGCTGAAGGAAGG - Intergenic
1072524017 10:96255555-96255577 TCCTACATGCAGATTAAACAGGG - Intronic
1075473164 10:122709258-122709280 TACCAAATCCAGATGGAGCACGG + Intergenic
1076886102 10:133263181-133263203 CCCCCCATCCAGAGGAAGCAAGG - Exonic
1076947382 10:133660516-133660538 TCCAACTTCCAGGGGAAGCAAGG - Intergenic
1077251538 11:1563010-1563032 CCCTGCATCCAGTGGAAGCAGGG - Intronic
1078532152 11:12145031-12145053 GCCCACATCCTGATGAAGGAAGG + Intronic
1079008589 11:16810273-16810295 TTCAAGATCCAGATGAAGGAAGG - Intronic
1081222581 11:40479945-40479967 TCATACATCCAGTAGAAGCAAGG - Intronic
1082271090 11:50170174-50170196 TACTACATTCAAATGAAACATGG + Intergenic
1085739770 11:79068942-79068964 TACTGCAGCCAGATGAAGCTTGG - Intronic
1086133512 11:83423877-83423899 TCCTACAGCCAGAGGCTGCATGG - Intergenic
1086348012 11:85917416-85917438 TCCTACATCTTGATGGAGGAAGG + Intronic
1092067198 12:5600802-5600824 TCCTACATCCAGATGAAGCATGG - Intronic
1096990761 12:55800628-55800650 TCCTAAAACCAAATGAAACAAGG + Exonic
1105776591 13:23667758-23667780 TCATACAGACAGATGAAGAAGGG - Intronic
1107443487 13:40449174-40449196 TCCCACCTCCAGATGAGACAAGG + Intergenic
1108347061 13:49556608-49556630 TCCTGCAGCCACGTGAAGCAGGG - Intronic
1109593874 13:64524081-64524103 TCCTAAAGCCAGATGGAGAAAGG + Intergenic
1111358204 13:87139066-87139088 TCCTACATGCAGATGATTAAAGG - Intergenic
1112138867 13:96615498-96615520 GTCTACATCCAGATGATGAATGG - Intronic
1114219474 14:20683821-20683843 TCCTCGATCCAGATGCAGGATGG - Intergenic
1114327442 14:21603328-21603350 TCCTAAGTCCAGAGGAAGGAGGG - Intergenic
1118370934 14:65136645-65136667 TGCAACATACGGATGAAGCATGG - Intergenic
1119205995 14:72793907-72793929 ACCTCCATCCAGAAGCAGCAAGG - Intronic
1119957219 14:78811478-78811500 TCCTACATGCAAAGGAAGCTGGG + Intronic
1121172262 14:91864359-91864381 GCCAACATTGAGATGAAGCAGGG - Intronic
1125911062 15:43439559-43439581 ACCTAAATGCAGATGAACCAAGG + Intronic
1127354866 15:58188492-58188514 TCCTTCCTGCAGAGGAAGCAGGG + Intronic
1130427767 15:83818897-83818919 TCCTACAGCCAGTTGAAGGCAGG + Intronic
1131152098 15:90053711-90053733 ACCCACATCAGGATGAAGCAAGG - Intronic
1131981670 15:98000313-98000335 TCCTACATTCAGGTGAAGGATGG - Intergenic
1133444610 16:5849369-5849391 TCCTACACCTTGAGGAAGCAGGG - Intergenic
1133498549 16:6343626-6343648 TTCTACATCTATAGGAAGCATGG - Intronic
1136910650 16:34141760-34141782 TCCTACTTCCAGAGGAGCCAGGG + Intergenic
1139510589 16:67426196-67426218 TCCTGCATCCAGATGAGGGACGG - Intergenic
1144245576 17:13360561-13360583 TCCTATTTCCAGATGTAGAAAGG + Intergenic
1145231129 17:21174076-21174098 CCCTCCATCCAGATAAAGTAGGG + Intronic
1146040716 17:29451475-29451497 TCATTCATACAGATGAACCAAGG + Exonic
1149620210 17:58038892-58038914 TCCTTCAACCATTTGAAGCAGGG + Intergenic
1151213478 17:72561736-72561758 TCCTACATCTACAAGAAGAATGG + Intergenic
1158696692 18:59709948-59709970 CACTCCATACAGATGAAGCAGGG + Intergenic
1163962299 19:20708509-20708531 ACCTACATCCAGATGTATCCAGG + Intronic
932914982 2:75847468-75847490 TCTTGCATCCAGAGGTAGCATGG - Intergenic
933011951 2:77076605-77076627 TGCTACATTGAAATGAAGCATGG + Intronic
937828169 2:126390295-126390317 TTCTACACACAGTTGAAGCAGGG - Intergenic
939010842 2:136844289-136844311 TCCTAAATCCAGAGGAACAAGGG + Intronic
941497752 2:166228201-166228223 TCCTACATGAATAAGAAGCATGG - Intronic
944458300 2:199917976-199917998 TCCTACCACCATATGAAGAAGGG - Intronic
945863049 2:215145712-215145734 TGGGTCATCCAGATGAAGCAGGG - Intergenic
946265527 2:218538095-218538117 TCCTACATCAAGCTGAAACGAGG + Intronic
948014537 2:234677320-234677342 TCCTAGATCCAGGAGGAGCATGG + Intergenic
1170822181 20:19763773-19763795 TCCTACATCAAACTGAATCAGGG - Intergenic
1171096224 20:22334665-22334687 TGCTTCTTCCAGAGGAAGCAAGG - Intergenic
1171906105 20:30900468-30900490 TCCTACTTCCAGAGGAGCCAGGG + Intergenic
1172406973 20:34697063-34697085 TCCAACATCCAGAGGGAGCTTGG - Intronic
1173574046 20:44098745-44098767 TCCTTCATCCAGATAAAGAATGG - Intergenic
1174304396 20:49604806-49604828 TCCCCCATGCAGATGAAGAACGG - Intergenic
1178334782 21:31732986-31733008 TCCTCCCTCCAGATGTAGCCTGG - Intergenic
1180339529 22:11606587-11606609 TCCTACTTCCAGAGGAGCCAGGG + Intergenic
1180972888 22:19824808-19824830 TCCTCCCTACAGATGAAGCAGGG + Intronic
1181430150 22:22875690-22875712 TCCTGCATCCAAATTTAGCAAGG + Intronic
950913655 3:16621080-16621102 TCACACATCCAAATGTAGCATGG - Intronic
951682049 3:25305108-25305130 TCCTACGTCCAGAGGCAGGAGGG - Intronic
952071968 3:29648127-29648149 ATCTACATCCAGAAGGAGCAAGG - Intronic
954102218 3:48382427-48382449 TTCTACATCAAGATGAATGAAGG + Intronic
955033895 3:55247994-55248016 TCCGACATCCACCTGCAGCAAGG + Intergenic
959286637 3:104421267-104421289 TCCTACCTTCAAATGAAGCTGGG + Intergenic
961014814 3:123459484-123459506 TCCTCCATACTTATGAAGCAGGG - Intergenic
961919433 3:130410503-130410525 TCCTAGTTCCAGAGGCAGCAGGG + Exonic
964281824 3:155076170-155076192 TCCTACATCCATTTGAAGTCTGG + Intronic
964682025 3:159352069-159352091 GCCGAAACCCAGATGAAGCAGGG - Intronic
965212575 3:165812498-165812520 TGCTAAATCCAGTTTAAGCATGG - Intronic
965966968 3:174503966-174503988 CCATACATCCAGGTGAAGCTGGG - Intronic
965983178 3:174718234-174718256 TCTTACATCCAGATAAAAAATGG - Intronic
968724521 4:2238138-2238160 TCAGACATCCAGATGAAGCCTGG + Intronic
968924734 4:3541314-3541336 TTGTCCATCCAGATGAAGAATGG + Intergenic
969305824 4:6325805-6325827 TCCCACATGCAGATGAGGCTAGG - Intronic
971950394 4:33337580-33337602 TCCTACATACAGCAAAAGCAAGG - Intergenic
972638432 4:40904790-40904812 TTCTCCATCCGGCTGAAGCAAGG + Intronic
973070176 4:45849056-45849078 TCCTAAATCCAGAACAAGCATGG + Intergenic
973156970 4:46967639-46967661 TCCTGGATGCAGAGGAAGCATGG - Intronic
974846643 4:67359077-67359099 TGGTGCATCCAGAGGAAGCATGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
980753304 4:137121125-137121147 TCCTACTTTCAGATGAAAGAAGG + Intergenic
980962193 4:139486372-139486394 TACTACTTCATGATGAAGCAAGG - Intergenic
984141255 4:176006022-176006044 TCCTATATCCAGACAAAGGAAGG + Intergenic
985450839 4:190061316-190061338 TCCAACTTCCAGGGGAAGCAAGG - Intergenic
986746541 5:10749953-10749975 TCCTTTCTGCAGATGAAGCAGGG - Intronic
987644989 5:20658609-20658631 TCCTACATTCAGTAGAAGTACGG - Intergenic
988641162 5:33041869-33041891 TGCTACATCCAAGTGCAGCAGGG - Intergenic
988781842 5:34529529-34529551 TCCTACATCCATGAGGAGCAAGG - Intergenic
993943745 5:94094228-94094250 TCCTACATCAAGGTCCAGCAGGG + Intronic
998988743 5:147791583-147791605 TCATTCATCCAGATGAATCAGGG + Intergenic
1000121787 5:158204557-158204579 TCTTACAGCCTGATGAAGCAGGG + Intergenic
1008768880 6:54954148-54954170 TCCTGCATCCTGATGAAGAATGG + Intergenic
1012858317 6:104528760-104528782 TCCTAGATAAAGATGAAGCTAGG - Intergenic
1014171731 6:118286332-118286354 ATCTTCATCCAGATGAAACAGGG + Intronic
1015450835 6:133364407-133364429 TCCAACACCCTGATGAAGCGAGG - Intronic
1015504285 6:133965800-133965822 TTCTCCATCCATATGAAGAAAGG + Intronic
1021132432 7:16927360-16927382 TCCTGCAGCCAGAAGAAGCCAGG - Intergenic
1021909539 7:25370261-25370283 TCCTACATTCAGCTGAAGAGGGG - Intergenic
1022513808 7:30962872-30962894 CCCTAAATCCAGATGTAGCGGGG + Intronic
1022863155 7:34389094-34389116 TCCTAGATCCAGACAAAGAAAGG - Intergenic
1027984986 7:85276133-85276155 TCCTATATCCAGACGCAGGATGG - Intergenic
1028051035 7:86186682-86186704 TCCTACAGGCAGATGAAGTTTGG + Intergenic
1031290226 7:119924908-119924930 TGTTACATCCATATGATGCATGG - Intergenic
1031763823 7:125748953-125748975 TCCTGCAGCTAGAAGAAGCATGG + Intergenic
1032428095 7:131837974-131837996 TCCTACATCCAGATGCAGGGCGG + Intergenic
1037071500 8:14655959-14655981 TGCTACATCCAGACGATGGATGG - Intronic
1037412833 8:18616444-18616466 TCCTAGATCCAGACGAGGGAAGG - Intronic
1037957801 8:23072265-23072287 TCCTGCATCCAGAAGTGGCAGGG + Intergenic
1039846193 8:41327224-41327246 TCATACAGCCAGATGAGACAAGG + Intergenic
1051011586 9:12421495-12421517 TCTTACATCCAGAGAAAGGAAGG + Intergenic
1053799807 9:41757289-41757311 TTGTCCATCCAGATGAAGAATGG + Intergenic
1054145404 9:61557644-61557666 TTGTCCATCCAGATGAAGAATGG - Intergenic
1054188215 9:61969344-61969366 TTGTCCATCCAGATGAAGAATGG + Intergenic
1054465148 9:65488761-65488783 TTGTCCATCCAGATGAAGAATGG - Intergenic
1054650299 9:67619232-67619254 TTGTCCATCCAGATGAAGAATGG - Intergenic
1055705244 9:78992406-78992428 TCATACTACCAAATGAAGCAAGG + Intergenic
1055975507 9:81950915-81950937 GCCTAGATCCAGATTAAGAAAGG - Intergenic
1056487070 9:87069857-87069879 TCCTCCTTCAAGATGAATCAGGG - Intergenic
1059060468 9:111030621-111030643 TCTGAGACCCAGATGAAGCAGGG + Intronic
1060861245 9:126956561-126956583 CCCCACCTACAGATGAAGCATGG - Intronic
1188427378 X:30064801-30064823 TTCTACATCCTGATGACGAATGG - Intergenic
1189326231 X:40113048-40113070 TCCTACATCCACCTGAGGCCAGG + Intronic
1193115931 X:77775214-77775236 TGCTTCATCCAGATGCAGCAAGG - Intronic
1195206313 X:102602833-102602855 TCCTAGTTCCAGTTGAAGGAGGG + Exonic
1196236636 X:113289175-113289197 TGCTAAAACCAGATGAAGAATGG + Intergenic
1197072071 X:122311582-122311604 TCCTACACCCAAATTATGCACGG + Intergenic
1202015215 Y:20398901-20398923 GCCTACTTCCTGATGAAGAAGGG + Intergenic