ID: 1092068776

View in Genome Browser
Species Human (GRCh38)
Location 12:5615531-5615553
Sequence TTGAGTAGACAAGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 385}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092068776_1092068781 9 Left 1092068776 12:5615531-5615553 CCTTCCTCCTCTTGTCTACTCAA 0: 1
1: 0
2: 3
3: 46
4: 385
Right 1092068781 12:5615563-5615585 TCACACCGCCCTCCTCAAAGAGG 0: 1
1: 0
2: 3
3: 11
4: 129
1092068776_1092068782 10 Left 1092068776 12:5615531-5615553 CCTTCCTCCTCTTGTCTACTCAA 0: 1
1: 0
2: 3
3: 46
4: 385
Right 1092068782 12:5615564-5615586 CACACCGCCCTCCTCAAAGAGGG 0: 1
1: 0
2: 0
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092068776 Original CRISPR TTGAGTAGACAAGAGGAGGA AGG (reversed) Intronic
900890803 1:5448359-5448381 TTGAGGAGACAGGGGCAGGAGGG + Intergenic
902278763 1:15359174-15359196 AAGAGGAGACAAGAGGAGTAAGG + Intronic
902280277 1:15369346-15369368 TAGGGTAGAGAAGAGGAGGATGG - Intronic
903337819 1:22636681-22636703 TGGAGTTGACAACAGGAGGCAGG + Exonic
903449324 1:23442261-23442283 TTGAGCAGATACTAGGAGGAGGG + Exonic
903488292 1:23707843-23707865 GTGAGAGGGCAAGAGGAGGAGGG + Intergenic
903602367 1:24552007-24552029 ATGAGAAGACAAGAGAATGACGG - Intergenic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905585646 1:39115468-39115490 TAGAGAATATAAGAGGAGGAAGG + Intronic
906107112 1:43301103-43301125 ATGAGAAGCCAAGAAGAGGATGG - Exonic
907273829 1:53306010-53306032 TAGAATAGAGAAGGGGAGGAGGG - Intronic
907481653 1:54749054-54749076 TAGGGAACACAAGAGGAGGAAGG - Intergenic
908062905 1:60371246-60371268 TTCAGAAGACAAGAAGATGAGGG + Intergenic
908164868 1:61448154-61448176 GTGAGGAGAAAAGGGGAGGAAGG - Intronic
908267593 1:62394637-62394659 TAGTGTAGACAATGGGAGGAAGG + Intergenic
908316392 1:62937024-62937046 TTGTGTTGACAGTAGGAGGAAGG + Intergenic
909570530 1:77105067-77105089 TTGTGTAGACAATTGAAGGATGG + Intronic
909903942 1:81173994-81174016 TTGGGAAGACAAGAAAAGGAGGG - Intergenic
909977780 1:82065472-82065494 TTGAGTAGCAAAGATGATGATGG + Intergenic
910438449 1:87228787-87228809 TTGACTACAGAAGAGGAAGAAGG + Intergenic
911209592 1:95125513-95125535 AAGACTAGTCAAGAGGAGGAGGG + Intronic
912073838 1:105847780-105847802 TTAAGGAGAAAAGAGGAAGATGG - Intergenic
912963998 1:114221265-114221287 TTGAGTAGGCAAAAGGAGATTGG - Intergenic
913304997 1:117419370-117419392 TTGACTAAATATGAGGAGGAAGG - Intronic
915979878 1:160413673-160413695 ATGAGAAGGCCAGAGGAGGAGGG - Intronic
916792059 1:168133967-168133989 AGGAGTAGAGAAGAGGTGGAGGG + Intronic
917335749 1:173922864-173922886 TTGGGGAGAGAAGAGGAGCAGGG + Intergenic
918004332 1:180527425-180527447 TTCAGTAGGCCAGAGGGGGAAGG + Intergenic
918326067 1:183411907-183411929 TTGAGTAAAGAATTGGAGGAGGG + Intronic
918340338 1:183563358-183563380 TGGAGGAGGGAAGAGGAGGATGG - Intronic
918778178 1:188665352-188665374 ATTAGTAGACAGGTGGAGGAAGG - Intergenic
920523888 1:206651177-206651199 ATGAATAAAGAAGAGGAGGATGG - Intronic
920723539 1:208412430-208412452 TTAAGTAAACAAGAGGACAAGGG - Intergenic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
921255808 1:213338295-213338317 TGGAGAAGCCAAGAGCAGGAGGG - Intergenic
922727188 1:227927947-227927969 ATGAGGGGACAAGGGGAGGAGGG + Intronic
922950108 1:229551940-229551962 TTTAGAAAACTAGAGGAGGAGGG - Intronic
1063370321 10:5517134-5517156 ATGAGAAGACTAGAGGAGGCAGG + Intergenic
1064018692 10:11792305-11792327 TTGGGTAGACAAGAGGTAAATGG + Intergenic
1064057690 10:12111517-12111539 TCCAGTAGACAAGAAGAGAATGG + Intronic
1064633681 10:17342612-17342634 TAAAGTTGAAAAGAGGAGGAAGG + Intronic
1067991800 10:51222246-51222268 TAGAGTAGACAAGTGAAGGTGGG - Intronic
1068135517 10:52948684-52948706 GTGAGGAGAAAAGAGTAGGAAGG + Intergenic
1068944825 10:62719261-62719283 TTGTGTAGACAAGAGGTGGGTGG - Intergenic
1069043194 10:63716111-63716133 TTGAGAAAACAAAAGCAGGAAGG + Intergenic
1069546464 10:69332842-69332864 TTGAGTAGCCAAGTGGAGGACGG + Intronic
1070622791 10:78026693-78026715 ATGAGAAGATAAGAGGATGAAGG - Intronic
1070653834 10:78257102-78257124 CTGAGGAGACAAGTGGAGAAAGG + Intergenic
1070967127 10:80536482-80536504 AAGAGGAGACAAGGGGAGGAAGG - Intergenic
1071290353 10:84184646-84184668 ATGAGTAGACAAGAGGGACAAGG - Intronic
1071847985 10:89539326-89539348 CTGAGTAGGGAAGAAGAGGAAGG - Intronic
1072348553 10:94534274-94534296 ATGAGTAAAGAAGATGAGGATGG - Exonic
1073377108 10:103045253-103045275 TTGAGCAGAGGAGACGAGGAGGG - Intronic
1073483201 10:103799823-103799845 TTGAGGAGGGAAGAGGAAGAAGG + Intronic
1073898765 10:108194388-108194410 GTGAATAGACAAGAGGACCAGGG - Intergenic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075092149 10:119449843-119449865 TTGAGCAGGCAGGGGGAGGATGG + Intronic
1075229199 10:120658369-120658391 TTGAGTAGCCAGGAGGAGCAGGG + Intergenic
1075868177 10:125745619-125745641 TTGATGAGATAAGAGGAGGATGG - Intronic
1076244802 10:128938486-128938508 TTGGCTAGAGAAGAGGAAGAAGG + Intergenic
1077644331 11:3910033-3910055 TTGAGCAGCCATGAGTAGGAAGG + Intronic
1077876384 11:6311528-6311550 TTGCTTAAACAATAGGAGGAGGG + Intergenic
1078897522 11:15610160-15610182 TTGAGTAGAAAAGTGTTGGAAGG - Intergenic
1080299378 11:30767621-30767643 TTGACTACAAAAGAGGAGGTAGG - Intergenic
1080515310 11:33014909-33014931 GTGAGGAGAGAAAAGGAGGAAGG - Intergenic
1080638442 11:34143597-34143619 TTGACTAGAAAATAGGAGGTTGG + Intronic
1081487329 11:43541568-43541590 TTTCATAGACAAGAGGATGATGG + Intergenic
1081960780 11:47135164-47135186 GTGAGAAGAAGAGAGGAGGAAGG - Intronic
1082222673 11:49659209-49659231 TTGAGTAGACATCTGGATGAAGG - Intergenic
1083617550 11:64034124-64034146 TTTAGTTCAGAAGAGGAGGAAGG + Intronic
1084566528 11:69931787-69931809 GTGAGAAGCCAAGAGGTGGATGG - Intergenic
1085374856 11:76050954-76050976 TTGAGATGAGAAGAGGAGAAAGG - Intronic
1085786107 11:79451709-79451731 TTGAGTAGAGAGGATGATGAAGG - Intergenic
1085850781 11:80117152-80117174 TTGAGCACAAAGGAGGAGGAGGG - Intergenic
1086353119 11:85963652-85963674 TTGATTAGAGTAGTGGAGGAGGG - Intronic
1086626374 11:88959997-88960019 TTGAGTAGACATCTGGATGAAGG + Intronic
1087216333 11:95499241-95499263 TTGAGGAAACAATGGGAGGAGGG - Intergenic
1088458812 11:110061080-110061102 TTGAGTAAGCAAGAGGGGAATGG + Intergenic
1088698631 11:112392043-112392065 GTGAGTAGAAAAGAGGAGCAGGG - Intergenic
1089205298 11:116756589-116756611 TTTAGTAGGCAAGAGGAGATGGG + Intronic
1089483000 11:118822287-118822309 TGGAAAAGACAAGAGAAGGAGGG - Intergenic
1089739431 11:120572112-120572134 GTGAGAAGACAACAGGAAGATGG - Intronic
1090431878 11:126653143-126653165 TTAAGTAAACAAGAGAATGATGG + Intronic
1090807279 11:130210396-130210418 TCGAGTAGGAAAAAGGAGGAAGG - Intergenic
1091325030 11:134679636-134679658 TGGAGGAGTCAGGAGGAGGAGGG + Intergenic
1092068776 12:5615531-5615553 TTGAGTAGACAAGAGGAGGAAGG - Intronic
1094435352 12:30415063-30415085 TTGAGTAGATAAGAGGAGGTGGG - Intergenic
1096024897 12:48351706-48351728 TTGACTAGAAAAGATGAGAAGGG + Intergenic
1097587696 12:61534115-61534137 ATGTGCAGAGAAGAGGAGGAAGG - Intergenic
1097625430 12:61994373-61994395 TTGAAAAGGCAACAGGAGGAAGG - Intronic
1098911513 12:76213938-76213960 AAGAGAAGAGAAGAGGAGGAGGG - Intergenic
1098922615 12:76316147-76316169 ATGAAAAGACAAGGGGAGGAAGG + Intergenic
1100245015 12:92748922-92748944 GTGTGTAGACAAGAAGAGGATGG - Intronic
1101082716 12:101205548-101205570 TAGAGTAGAAAAGAAGAGGAAGG + Intronic
1102397582 12:112600455-112600477 TGGAGGAGACCAGAGTAGGATGG - Intronic
1103281721 12:119763397-119763419 TTTTGTAGACAAGATGAGAAGGG + Intronic
1104616374 12:130273354-130273376 AGGAGGAGAAAAGAGGAGGAGGG - Intergenic
1105792148 13:23812291-23812313 TTAACTAGACAAGAGAAGGATGG + Intronic
1106495777 13:30273043-30273065 TTGAGGTGACAAGAGGAGATGGG - Intronic
1107542463 13:41403865-41403887 TTGAGGATACAACAGGAAGATGG - Intergenic
1108031373 13:46233198-46233220 TTGAGTAGAAATGAGGAAGATGG - Intronic
1108609292 13:52068626-52068648 TTCAGTAGAAAAAAGGATGAAGG + Intronic
1109749165 13:66666906-66666928 TTAAATATAAAAGAGGAGGAGGG - Intronic
1110228403 13:73143600-73143622 ATGGGTGAACAAGAGGAGGAAGG - Intergenic
1111194841 13:84860981-84861003 TTGAGTAGCCAAGAGGGTGGTGG - Intergenic
1111233275 13:85372761-85372783 GAGAGGAAACAAGAGGAGGAGGG - Intergenic
1112790995 13:103002114-103002136 TGGAGTAGAGAGGAGGAGCAGGG - Intergenic
1112819832 13:103319338-103319360 TTCAGAAGAAAAAAGGAGGAGGG - Intergenic
1113558364 13:111256620-111256642 GTGAGCAGGGAAGAGGAGGAAGG - Intronic
1114129847 14:19778325-19778347 TGGAGTAGAGCAGAGGAGGAAGG + Intronic
1114134348 14:19830079-19830101 TTTAGTAGAGAGGAGGGGGATGG - Intergenic
1114552112 14:23538711-23538733 TGAAGGAGGCAAGAGGAGGAAGG + Intronic
1115275627 14:31605928-31605950 AAGAGAGGACAAGAGGAGGAGGG - Intronic
1115862703 14:37706361-37706383 ATGAGGAGACACCAGGAGGAGGG - Intronic
1117383428 14:55188072-55188094 TTGAGAGGACAAGATGAGAAAGG + Intronic
1117622881 14:57605948-57605970 TGGGGAAGACAAGAGGGGGAAGG + Intronic
1118339614 14:64883257-64883279 TAAAGGATACAAGAGGAGGAGGG + Intergenic
1118625028 14:67650823-67650845 TTGGTCAGACAAGAGAAGGAGGG + Exonic
1118727907 14:68643466-68643488 TTAAGGAGACCAGAGGAGGATGG + Intronic
1119045996 14:71319868-71319890 GCGAGTTGAGAAGAGGAGGAGGG + Intergenic
1119851048 14:77866993-77867015 ATGAGTAAATAAGAGGAGGATGG - Intronic
1120856855 14:89220088-89220110 ATGAGAAGAAAGGAGGAGGAAGG - Intronic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1122647895 14:103207278-103207300 GAGAGGAGAAAAGAGGAGGAGGG - Intergenic
1123573128 15:21636034-21636056 TGGAGTAGAGCAGAGGAAGAAGG + Intergenic
1123609748 15:22078653-22078675 TGGAGTAGAGCAGAGGAAGAAGG + Intergenic
1124452384 15:29807485-29807507 TCAGGTAGACAGGAGGAGGAAGG + Intronic
1124698373 15:31887670-31887692 ATGAGTAGACAGAAGGGGGATGG + Intergenic
1124826477 15:33101269-33101291 TTGAGTATACTGGAGGAGGTTGG + Intronic
1126416536 15:48423651-48423673 TAGAGGGGAGAAGAGGAGGAAGG - Intronic
1126981495 15:54249350-54249372 TTAAGCAGAGCAGAGGAGGAGGG + Intronic
1127468992 15:59273619-59273641 CGGAGGAGACCAGAGGAGGAAGG + Intronic
1127468999 15:59273662-59273684 CGGAGGAGACCAGAGGAGGAAGG + Intronic
1128490959 15:68143788-68143810 TTTAGGAGAGAAGAGGAGGATGG - Intronic
1129178805 15:73858732-73858754 TTCAGAGGACAAGATGAGGATGG - Intergenic
1130034691 15:80347368-80347390 TTGTGTAAACAAGAGGAAAAGGG + Intronic
1130836056 15:87651264-87651286 TTAGGTAGACAAGAGCAGGATGG + Intergenic
1131671597 15:94625680-94625702 TTGAGGAGTCAGGAGGAGGTTGG + Intergenic
1132088865 15:98931139-98931161 TTGAGAAGTCAGGAGGAGAATGG + Intronic
1134133852 16:11667456-11667478 TTGAGAAGACAGGAGGGGGCAGG - Intergenic
1136138883 16:28276162-28276184 TTGAGGAGAGAGGAGGAGGTGGG + Intergenic
1136895874 16:33995672-33995694 TTGAGTAAACCAGAGAAGGCAGG + Intergenic
1136922739 16:34345578-34345600 CTGAGCAGACAGGAGTAGGAGGG + Intergenic
1136981834 16:35066228-35066250 CTGAGCAGACAGGAGTAGGAGGG - Intergenic
1137398002 16:48130659-48130681 TTGAGTTGACATTGGGAGGAGGG - Intronic
1138799357 16:60007980-60008002 TTGAGGAGGAAAGAGGGGGATGG + Intergenic
1138922273 16:61546219-61546241 TTGATAAGACAAGAGAAGGAAGG + Intergenic
1140185189 16:72763338-72763360 TTGAAGAAAGAAGAGGAGGAGGG + Intergenic
1140278042 16:73528573-73528595 TAGAGTAGAAAAGTGCAGGAGGG + Intergenic
1140281198 16:73556733-73556755 TTGAGTAAAGAAGACCAGGATGG - Intergenic
1140868382 16:79084127-79084149 TTGAGGAGACCAAAGGAGGGTGG + Intronic
1141689217 16:85587078-85587100 TGGAGGAGACAATAGTAGGATGG + Intergenic
1142404910 16:89882970-89882992 TTGAGGAGAAAGGAGGAAGAAGG + Intronic
1143043494 17:4057422-4057444 ATGTGTAGAAAAGAGGAGAAGGG - Intronic
1143500456 17:7335759-7335781 TTGAGGAGAGGGGAGGAGGAAGG + Intergenic
1143574366 17:7781679-7781701 TTGAGTAGGTCAGCGGAGGAGGG - Intronic
1143873489 17:9974715-9974737 TTGGGTAGAAAAGAGGAGGGAGG + Intronic
1144070489 17:11666990-11667012 TTTACTAGGTAAGAGGAGGAGGG - Intronic
1144518960 17:15941779-15941801 TTCAGGAAACACGAGGAGGAAGG - Intergenic
1144579236 17:16448764-16448786 TTGAGGACACAGGAGGAGGAGGG + Intronic
1144693127 17:17281906-17281928 TTTAGGCGACAAGCGGAGGAGGG - Intergenic
1146669959 17:34730394-34730416 TTGAGGAGCCAACAGGAAGAAGG + Intergenic
1146836712 17:36117014-36117036 TGGAGAAGAGAAGAGGAAGAAGG - Intergenic
1146927775 17:36757055-36757077 TTGAGGAGAAAGGAGGATGAGGG + Intergenic
1147170780 17:38617555-38617577 CTGAGTGGAAAAGAGGAGGAGGG + Intergenic
1148148140 17:45378966-45378988 TGGAGTAGACAGTCGGAGGATGG - Intergenic
1148758663 17:49987920-49987942 TAGAGGAGAGGAGAGGAGGAAGG + Intergenic
1149132659 17:53323941-53323963 CTGAGGAGACAACAGGAAGAAGG + Intergenic
1149729358 17:58929305-58929327 TTGACTGGAAAGGAGGAGGATGG + Intronic
1149951202 17:60988424-60988446 TTGAGAAGAATAGAGGAGGAAGG - Intronic
1150213588 17:63454872-63454894 ATGAGAAGCCAACAGGAGGAGGG + Intergenic
1151219123 17:72599127-72599149 TTGAGGGGAGAAGAAGAGGATGG - Intergenic
1151297206 17:73194073-73194095 TTGATTAGACACAATGAGGAAGG + Intronic
1153123927 18:1766371-1766393 TTGAGGAGAAAAGAAAAGGAAGG + Intergenic
1153596158 18:6727401-6727423 GTGAATTCACAAGAGGAGGAGGG + Intergenic
1155034604 18:22015395-22015417 TCCAGCAGAGAAGAGGAGGAAGG - Intergenic
1155146333 18:23086717-23086739 TTGTGTAGGCAAGAGCAGGATGG - Intergenic
1155999133 18:32365553-32365575 GGAAGTAGAAAAGAGGAGGAAGG + Intronic
1156185299 18:34655370-34655392 TTGAGCAGGCAAGTGGAGGTGGG - Intronic
1156870809 18:41942881-41942903 ATGAGTAGAAAAGAGGAAAAGGG + Intergenic
1157079286 18:44505255-44505277 TTGTGAAGACAAGACCAGGATGG - Intergenic
1157872339 18:51242027-51242049 TTGAGTAGAGAGGATGATGAAGG + Intergenic
1160887644 19:1358735-1358757 TCCAGTACACAAGACGAGGAAGG + Intronic
1160916841 19:1500808-1500830 TGGAGCAGAGAAGGGGAGGAGGG + Intergenic
1161364309 19:3869217-3869239 TTGAGTGGTTAAGAGGAGGGCGG - Intergenic
1162927098 19:13936170-13936192 TTGAGTAGGGATGGGGAGGAGGG - Intronic
1163383699 19:16986039-16986061 TTTAGTAAAGAAGAGGAGAAAGG - Intronic
1164062851 19:21690488-21690510 GTGAGGAGAAAAGAGTAGGATGG + Intergenic
1164734324 19:30529638-30529660 TTGAGAAGACAAAATTAGGAAGG + Intronic
1165194474 19:34090870-34090892 TTGAGAAGGCAAGAGGGGAAAGG + Intergenic
1165928812 19:39343031-39343053 TTCTGGAGACAGGAGGAGGACGG - Intronic
1166248552 19:41549006-41549028 TTGAGTCCAGAAGAGGAAGAAGG - Intergenic
1167646915 19:50710918-50710940 AGGAGTAGAAAAGAGGAGAAAGG - Intronic
1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG + Intergenic
1167984411 19:53302233-53302255 TTGGGTAGACAGGGGTAGGAGGG - Intergenic
1168495258 19:56842489-56842511 TTGAGGAGACAGGGGGATGATGG - Intergenic
925943328 2:8839648-8839670 GTGAGAGGATAAGAGGAGGATGG - Intergenic
926395885 2:12441804-12441826 TTGAGCAGGTAACAGGAGGAAGG + Intergenic
926654128 2:15381104-15381126 TTGAGTAGACCAGAGAAATATGG - Intronic
926820501 2:16846952-16846974 TTGAAAAGAGAAGAGGAAGAAGG + Intergenic
927289401 2:21390559-21390581 TCGAGTAGAAAACATGAGGATGG + Intergenic
927430874 2:23025249-23025271 TTGAGTGCACAAGAGGAGAGAGG + Intergenic
927461044 2:23298408-23298430 TTGAGCAGAGAAGAGGAGGGAGG - Intergenic
927871795 2:26628726-26628748 CTGAGAAGACAGGAGGAGCAGGG - Intronic
928157277 2:28888185-28888207 TTGACTAGGCAAGAGGGGAATGG + Intergenic
929570201 2:43018142-43018164 TGGAGTGGAGAAGAGGAGGTTGG + Intergenic
930511279 2:52348533-52348555 CTGAGTAGACAAGAAGGAGAAGG - Intergenic
930947426 2:57092337-57092359 TTTAGGAGAGAAGAGTAGGAAGG - Intergenic
930992248 2:57670740-57670762 TTGACTAGAGAAGAGCAGGAGGG - Intergenic
931162995 2:59714851-59714873 TTGAGAAGAGAAGAGGAGGTAGG - Intergenic
931811996 2:65863206-65863228 CTAAGTGGACAAGAGGAGGTAGG - Intergenic
932123345 2:69121123-69121145 ATGAGCACACAAAAGGAGGAGGG - Intronic
932547809 2:72733399-72733421 TTGGGGAGACAAGAGGAAAAAGG + Intronic
932825105 2:74932009-74932031 TTGAGTAGGCAAGAGGGGATGGG + Intergenic
933633442 2:84681878-84681900 TTGAGTAGACAGGAGGGGACTGG - Intronic
933918003 2:87016201-87016223 TTTATGAGACCAGAGGAGGAAGG - Intronic
934004992 2:87753713-87753735 TTTATGAGACCAGAGGAGGAAGG + Intronic
934819312 2:97358175-97358197 ATGAGTAGAAGAGGGGAGGAAGG + Intergenic
935360072 2:102239367-102239389 AGGCGTAGAGAAGAGGAGGATGG + Exonic
935767949 2:106387744-106387766 TTTATGAGACCAGAGGAGGAAGG + Intergenic
935784402 2:106535651-106535673 TTGAGTAGAGAAAAGTAGAAGGG - Intergenic
938666724 2:133546445-133546467 TGGAGTATACATGAGCAGGACGG - Intronic
939437787 2:142200859-142200881 GTGATTAGACAAAAGGAAGAAGG - Intergenic
939670874 2:145010571-145010593 TTGAGAAGCCCGGAGGAGGATGG + Intergenic
940258509 2:151757332-151757354 GTGAGGATACAAGAGGAAGATGG + Intergenic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
943772293 2:191731663-191731685 TTGAGTAGACTATAGGGGAAGGG + Intergenic
943872172 2:193013593-193013615 TTGAGTAGCCAAGATGAGGTGGG - Intergenic
944633985 2:201656777-201656799 TTGAGCAGACATCTGGAGGAAGG + Intronic
945509749 2:210686589-210686611 AAGAGTAAACAAGAGCAGGAGGG + Intergenic
946322931 2:218963976-218963998 CTGAGAAGGCAAGGGGAGGAGGG + Intergenic
948157308 2:235793644-235793666 TTGAGCAGCAAAAAGGAGGAAGG + Intronic
948217219 2:236240629-236240651 TTGAGTGGGCAGGGGGAGGAGGG + Intronic
948342955 2:237269924-237269946 TTGAGGTGAGAAGAGGTGGAGGG - Intergenic
948691946 2:239711680-239711702 CTGAGGAGAAAAGAGGAGGATGG - Intergenic
948870132 2:240793548-240793570 GTGAGGAGAGAGGAGGAGGACGG + Intronic
1169081405 20:2799661-2799683 TAGAGGAGGCAAGTGGAGGAGGG - Intronic
1169812495 20:9622474-9622496 TGAAGTAAACATGAGGAGGAGGG + Intronic
1172151943 20:32796896-32796918 TAGAGGAGGCAAGGGGAGGAAGG - Intronic
1172602382 20:36192800-36192822 TAGAGTAGCCATGAGGAGGGAGG + Intronic
1172785468 20:37465472-37465494 GAGAGGAGAGAAGAGGAGGAAGG - Intergenic
1172868999 20:38123299-38123321 TTGAGCCCAGAAGAGGAGGAGGG - Intronic
1173079026 20:39848488-39848510 TGGAGTGCACAAGATGAGGATGG + Intergenic
1173142769 20:40498726-40498748 TGCAGGAGACGAGAGGAGGAAGG - Intergenic
1173976581 20:47191400-47191422 ATGAGTAGATAAGTGGTGGATGG + Intergenic
1174759570 20:53193806-53193828 TTGAGTTGACAATAAGAGGGAGG + Intronic
1174828331 20:53789776-53789798 TTCAGGAGAAAAGTGGAGGATGG - Intergenic
1174872602 20:54197135-54197157 CTGCGAAGACATGAGGAGGAGGG - Intergenic
1175305006 20:57969793-57969815 TTGAGAAGATGAGAGGACGAGGG + Intergenic
1175543494 20:59762918-59762940 TGGAGAGGACAAGAGAAGGATGG + Intronic
1179818993 21:43925525-43925547 GTGGGTAGACAAAAGGGGGAGGG + Intronic
1182372961 22:29825099-29825121 GTGAGTGGACATGCGGAGGAAGG + Exonic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
1185206108 22:49539945-49539967 ATCAGTAAACAAGAGGATGAAGG - Intronic
949661058 3:6279145-6279167 TTGAGTAGACTAGAGGAAAGTGG + Intergenic
950215535 3:11155618-11155640 TGGAGCAGACAAGACGAGGCAGG + Intronic
951040426 3:17983270-17983292 GTCAGTTGAAAAGAGGAGGAAGG - Intronic
952257997 3:31712023-31712045 TAAAGTAGCCAAGAGAAGGAGGG + Intronic
953276431 3:41504145-41504167 TTGAGCAGAGAAGTGAAGGAAGG - Intronic
953839128 3:46374661-46374683 TTGGGAAGACATGGGGAGGAAGG + Exonic
953989230 3:47471187-47471209 ATGAGTACAGAAGAGGAGGCAGG + Intronic
954968364 3:54630484-54630506 GTGAGTCTGCAAGAGGAGGATGG - Intronic
955085809 3:55701652-55701674 TTAAGTGGACAAGTGAAGGATGG - Intronic
956070310 3:65442448-65442470 TTCAGTAGACCAGATGAAGAGGG - Intronic
957362380 3:79175975-79175997 TTGAGTATGAAAGTGGAGGAAGG - Intronic
957404413 3:79758653-79758675 TTGAGAAGACAAGAAGGGGAAGG + Intronic
957920112 3:86735865-86735887 ATGGGTAGAAAAGAGAAGGAAGG - Intergenic
958735938 3:98009785-98009807 TTGAGTTAACCAGAGGAGTAGGG + Intronic
960036772 3:113109973-113109995 TGGAAAAGAGAAGAGGAGGAGGG + Intergenic
960046448 3:113203459-113203481 ATGAGTGGAAAAGAGGAGAAAGG + Intergenic
960179114 3:114553780-114553802 TTGAGTAGATGAGAAGAGGAAGG + Intronic
961675981 3:128567038-128567060 TTCAATAAAAAAGAGGAGGAAGG + Intergenic
961745231 3:129060323-129060345 TTGAGTATACAGGAGGAGGGAGG + Intergenic
961801437 3:129453151-129453173 TTGAGTAGGCAAGAGGAGATGGG + Intronic
962203082 3:133415868-133415890 GTGAGTAGAGAAGAGGGCGAGGG - Intronic
962682554 3:137815290-137815312 TAGAGTTGTCAGGAGGAGGAGGG + Intergenic
963066805 3:141270723-141270745 TGGAGTGGCCAAGAGGAGAAGGG + Intronic
963272701 3:143301521-143301543 TTCAGTAGGCAAGAGTAGAATGG + Intronic
963341972 3:144047137-144047159 TTGAGTAAAAAGGAGGAGGGAGG - Intronic
963495356 3:146052870-146052892 TTGAGGAGACAAGAGAAGCTCGG - Intergenic
963823411 3:149924869-149924891 TTGAGAAGGCAAGAGGAGATTGG + Intronic
964635429 3:158853150-158853172 TAGAGTAGACAAGACAAGGTTGG - Intergenic
967621375 3:191638784-191638806 CTGTGAAGACAAGAGGAAGATGG + Intergenic
967746474 3:193061374-193061396 TGGAGGAGATAGGAGGAGGAGGG - Intergenic
968428372 4:537750-537772 TGGAGAAGCCAAGAGGAGGATGG + Intronic
969100753 4:4766401-4766423 TTGAATAGAGAAGCGGGGGAGGG + Intergenic
969224794 4:5788561-5788583 TTTAGTAGAAAAATGGAGGAAGG - Intronic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
970260181 4:14216273-14216295 GTGAAGAGACCAGAGGAGGAAGG + Intergenic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
972163533 4:36254668-36254690 TAGAGTAGACAAGATGAAGTTGG + Intergenic
972171406 4:36350103-36350125 TTGAGTACACAGGAGGAGGGTGG - Intergenic
974549557 4:63353323-63353345 TTGGTTAGAAAAGAGCAGGAAGG + Intergenic
975523424 4:75324393-75324415 CTAAGTAGACCAGAGGAGAAAGG - Intergenic
975663995 4:76716032-76716054 TTTTGTGGGCAAGAGGAGGAGGG - Intronic
978676745 4:111327383-111327405 TTGAGTAGAGAAGAGTGGGAAGG - Intergenic
978737422 4:112099747-112099769 TTGAATTGGCAAGAGGAGGAGGG + Intergenic
979982104 4:127269718-127269740 TTGAGTACAAAAGGGGATGAAGG + Intergenic
980240450 4:130167110-130167132 TTAATTTGACAAAAGGAGGAGGG - Intergenic
980284283 4:130761587-130761609 TAGAGTAGAAAAGGGGAGAAAGG + Intergenic
980773921 4:137414956-137414978 TTGATTAGGCAAGAGGATGACGG - Intergenic
982307520 4:153948433-153948455 TCCAGGAGACAAGAGGAGCAGGG - Intergenic
982760973 4:159282988-159283010 TTGAGTATGTAAGAGGAGCATGG + Intronic
983693082 4:170496237-170496259 TGGAGAATACAAGAGGAGAAAGG - Intergenic
985957654 5:3276876-3276898 TTGAGTTGATAGCAGGAGGAAGG - Intergenic
986251001 5:6058595-6058617 TTGGGCAGACAGGAGGCGGAAGG - Intergenic
987044921 5:14099033-14099055 TTGCAGAGACAAGAGGAGAATGG - Intergenic
987171977 5:15268797-15268819 TTAAGTAAACAAGAGGGGTATGG + Intergenic
989271566 5:39539631-39539653 TTGAATAGATAAGAGGGGAAGGG + Intergenic
989458275 5:41667207-41667229 TAGAGGAAACAAGAGGAAGAAGG + Intergenic
990109196 5:52303258-52303280 TTGAGTATACCTGAGTAGGAAGG + Intergenic
990929961 5:61077702-61077724 TTGAGAAGACAAGATGAGGCAGG + Intronic
990978612 5:61581159-61581181 ATGAGCAGAGAAGAGGATGAAGG + Intergenic
993273662 5:85828376-85828398 TTGACTAGACAAGAGGTGAAGGG + Intergenic
993408090 5:87537342-87537364 TTTACTAAATAAGAGGAGGAAGG + Intergenic
995685494 5:114767529-114767551 TGGAGTACAAATGAGGAGGAAGG + Intergenic
995803103 5:116021061-116021083 TGAAGTTGACAAGAGCAGGAAGG + Intronic
996800193 5:127395253-127395275 GTGAGTAGAAAAGGGGAGCAGGG - Intronic
996991896 5:129644962-129644984 TGGAAGAGAGAAGAGGAGGAAGG - Intronic
998731028 5:145077334-145077356 TCTAGCAGACAACAGGAGGAAGG - Intergenic
999452243 5:151687009-151687031 AGGAGGAGACAGGAGGAGGAGGG - Exonic
999969353 5:156843723-156843745 TTGAGTAGGCAAGAGGTGATTGG + Intergenic
999983602 5:156981700-156981722 TTGAAAAGAAAAGAGGAAGAGGG + Intergenic
1000344087 5:160300049-160300071 TTGGGGGGACACGAGGAGGAAGG - Intronic
1001132927 5:169079614-169079636 AGGAGGAGAGAAGAGGAGGAGGG + Intronic
1001422578 5:171598961-171598983 GTGAGTGGATAAGAGGAGGATGG + Intergenic
1002039833 5:176504760-176504782 TGGATTAGACAAGAGGAACATGG + Intronic
1002394798 5:178944238-178944260 GTCAGAAGCCAAGAGGAGGAGGG - Intronic
1003063706 6:2883776-2883798 TGGAGGAGGCAAGAAGAGGAAGG + Intergenic
1004969310 6:20891251-20891273 GTGAGGAGATAAGAAGAGGAAGG - Intronic
1006510634 6:34519318-34519340 TTGAGGAGGAAGGAGGAGGATGG - Intronic
1006883607 6:37360935-37360957 CTCAGTGGACAAGGGGAGGAGGG + Intronic
1007219638 6:40268437-40268459 ACAAGAAGACAAGAGGAGGAGGG + Intergenic
1007325856 6:41059036-41059058 TTGCCTAGGGAAGAGGAGGAGGG + Intronic
1007835364 6:44669856-44669878 TCCTGTAAACAAGAGGAGGAAGG + Intergenic
1007980244 6:46147382-46147404 GTGAGTACACTAGTGGAGGATGG - Intergenic
1010329030 6:74600351-74600373 TTCAGTGGATAAAAGGAGGAGGG - Intergenic
1010377396 6:75187190-75187212 TTAAGTAGAAAATAGTAGGAGGG + Intronic
1011038971 6:83009960-83009982 GAGAGTAGACAAATGGAGGAGGG + Intronic
1011538190 6:88401067-88401089 TGGAGTTGACATGGGGAGGAGGG - Intergenic
1011552160 6:88539778-88539800 TTAGGAAAACAAGAGGAGGAAGG + Intergenic
1011556097 6:88572821-88572843 TTGAGCAGACAAGAAGAGGAGGG + Intergenic
1011850503 6:91621966-91621988 TTAAGTAGACAAGAGTATGTGGG - Intergenic
1012142091 6:95636765-95636787 CAGAGCAGACAAGAGGAGCAGGG + Intergenic
1013085260 6:106851468-106851490 ATGAGAAGACAAGAGGATGACGG - Intergenic
1013132498 6:107247558-107247580 TTGAGTTAACAAGTCGAGGAAGG + Intronic
1013345287 6:109254217-109254239 TTGTGGAGACCAGAGGAAGAGGG + Intergenic
1013426463 6:110017316-110017338 CTGGGTAGACAAGAGGATGGTGG + Intergenic
1015355372 6:132271626-132271648 TGGAATAGAAAAGAGGAGGTGGG + Intergenic
1015496043 6:133884425-133884447 TTGAGGAGACAAGAGTTGCAGGG - Intergenic
1016479526 6:144467226-144467248 ATGAGCAGACAGGAGGAGGAGGG - Intronic
1016603432 6:145889971-145889993 TTGAGTAGGCAAGAGGATATGGG - Intronic
1017395416 6:153993264-153993286 TTGAATGTACAAAAGGAGGAAGG - Intergenic
1018128789 6:160707885-160707907 TTTATAAGACCAGAGGAGGAAGG + Intronic
1019021241 6:168919913-168919935 TTGAGAAGACCAGAGGTTGATGG + Intergenic
1019155235 6:170034120-170034142 CTAGGTAGACTAGAGGAGGAGGG - Intergenic
1020808756 7:12825283-12825305 TTGAGTCTACTAGAGGAGGGAGG + Intergenic
1022358573 7:29638725-29638747 GTGAGGAGAAAAGAGTAGGATGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023567820 7:41540966-41540988 TTGGGTAGACAACGGGAGGGTGG + Intergenic
1023892978 7:44406821-44406843 TGCAGAAGACAAAAGGAGGAGGG + Intronic
1024423998 7:49204640-49204662 TTGAGGGGACAAGTGGAGAAGGG - Intergenic
1024482849 7:49883120-49883142 TTGAGGGGAAATGAGGAGGAAGG + Intronic
1024698298 7:51879147-51879169 TTGAGAAGCAAAGAGCAGGATGG + Intergenic
1024996144 7:55274402-55274424 TTGAGTTGACACGAGTGGGAGGG - Intergenic
1025989056 7:66481348-66481370 TTGGGTGGCCAAGTGGAGGAAGG - Intergenic
1026769277 7:73184059-73184081 TTGGGTGGGCAAGTGGAGGAAGG + Intergenic
1027010147 7:74737442-74737464 TTGGGTGGGCAAGTGGAGGAAGG + Intronic
1027077895 7:75208593-75208615 TTGGGTGGGCAAGTGGAGGAAGG - Intergenic
1027136455 7:75627822-75627844 TTGAGTAGACCTCAGGATGATGG + Intronic
1027212017 7:76157365-76157387 TTGGGTGGCCAAGTGGAGGAAGG - Intergenic
1028266901 7:88736876-88736898 CTGAGTAGACAATAAGTGGATGG + Intergenic
1030557376 7:111043373-111043395 TTGAGAGGAAAAGGGGAGGAAGG - Intronic
1031070185 7:117153442-117153464 TAGAGTAAAAAAGAAGAGGAGGG + Intronic
1031200423 7:118677066-118677088 TTGAGGAGATAGGAAGAGGAAGG - Intergenic
1031624220 7:123973723-123973745 TTAAGTCGAGAAGAGGAGAAAGG + Intergenic
1032439786 7:131933700-131933722 TTCAGTGGAGCAGAGGAGGAAGG - Intergenic
1032721728 7:134555559-134555581 GTGAGGAGAAAAGAGTAGGAAGG - Intronic
1032859276 7:135862186-135862208 TTGAATAGAGAACAGGATGAAGG - Intergenic
1033015088 7:137663240-137663262 TTGAGGAGACAAGAGGAACTTGG + Intronic
1033327784 7:140393614-140393636 TTGACTAGCCAAGAAAAGGAAGG - Intronic
1034577253 7:152011130-152011152 TTGAGTAGACAGCATGAGGCAGG - Intronic
1035577967 8:720069-720091 TTCAGAAGACAAGAGGAGCAAGG - Intronic
1035779082 8:2213198-2213220 TAGAGCAGAAACGAGGAGGAGGG + Intergenic
1037449453 8:19001990-19002012 TTGACTAGACAAGGGGAGAAGGG + Intronic
1038220792 8:25605041-25605063 TTGATCAGCCAAGGGGAGGAAGG - Intergenic
1039011582 8:33099357-33099379 TGGAGAATACAAGAGCAGGAGGG + Intergenic
1040873029 8:52120539-52120561 CTGAGCATCCAAGAGGAGGAAGG + Intronic
1041731915 8:61070995-61071017 TTCTGTAGACAGGAGCAGGAAGG - Intronic
1042850582 8:73212253-73212275 TTGGGTAGACAGGATGAGGAAGG - Intergenic
1043394073 8:79819522-79819544 TTGAGTGGATAAGAGGAGAATGG + Intergenic
1043645493 8:82512451-82512473 TTGAGTGGACAAGATTATGAAGG + Intergenic
1045083861 8:98658520-98658542 TTGAGAAGAGAAGAGAATGAGGG - Intronic
1045756064 8:105543736-105543758 TTGAATACACAAAAGAAGGAAGG - Intronic
1045955078 8:107896535-107896557 TAAAGTAGAAAAGAGGAGAAAGG + Intergenic
1046151014 8:110225508-110225530 TGGAGTAGACAAGATGTGCATGG - Intergenic
1047404471 8:124573681-124573703 TCAAGCAGCCAAGAGGAGGAGGG + Intronic
1047946484 8:129886043-129886065 TTGAGGAGACAAAAGCAGGCAGG - Intronic
1048507698 8:135035595-135035617 GTTAGAAGACAAAAGGAGGAGGG - Intergenic
1050098816 9:2096617-2096639 GTAAGTAGGCAAGAGCAGGAAGG - Intronic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1052181767 9:25537478-25537500 GAGAGTAGTTAAGAGGAGGAAGG + Intergenic
1054770903 9:69083004-69083026 TTAGGTAGAAAAGAGGAGGTTGG - Intronic
1054771594 9:69088868-69088890 CTCAGAAAACAAGAGGAGGAAGG + Intronic
1056572473 9:87828123-87828145 TCAAGAAGACAAGAAGAGGATGG - Intergenic
1056672248 9:88640185-88640207 TGGAGGAGAGAGGAGGAGGAAGG + Intergenic
1057554357 9:96075796-96075818 TTATTTAAACAAGAGGAGGAGGG + Intergenic
1058387881 9:104460189-104460211 CTGAGTGAACAAGGGGAGGATGG + Intergenic
1058473944 9:105311353-105311375 TTGAGGAGATAAGAGGAAAAGGG + Intronic
1058545071 9:106052532-106052554 GTGGGTAGACGAGAGGTGGATGG - Intergenic
1059316008 9:113426383-113426405 TTGAGTGGAGAATGGGAGGAGGG + Intronic
1059411542 9:114135624-114135646 TGGAGAAGAAAAGAGGAAGATGG - Intergenic
1059869500 9:118556133-118556155 TAGAGTAGAGAAGAAGAGTAAGG + Intergenic
1060846690 9:126842899-126842921 GTGAATAGAAAAGAGGAGGAGGG - Intergenic
1061105267 9:128525290-128525312 CTGCGAAGACAAGAGGAGGCAGG + Exonic
1061114742 9:128602511-128602533 TTGAGTAAAGAACAAGAGGAAGG - Intronic
1062701203 9:137904676-137904698 TTGAGGGGACAGCAGGAGGAGGG - Intronic
1185975088 X:4711224-4711246 TTGAGTAAAGAAATGGAGGAGGG + Intergenic
1186488154 X:9950010-9950032 ATCAGTAGACACGAGGAGGCGGG - Intergenic
1187053940 X:15723075-15723097 CTGGGATGACAAGAGGAGGAGGG - Intronic
1189907901 X:45780589-45780611 TTGAGTAGAAGACAGGATGATGG + Intergenic
1191137781 X:57084094-57084116 CAGAGTAGACAAGTGAAGGAAGG + Intergenic
1192364597 X:70460741-70460763 TTGCTTAGACATGAGGGGGATGG - Intronic
1194346276 X:92771073-92771095 GTGTGTGGACAAGAGGAGGTTGG + Intergenic
1194924001 X:99802583-99802605 TTGAGTATAAAAGAGCAGAATGG + Intergenic
1195012093 X:100742682-100742704 TGGAGAAGATAAAAGGAGGATGG - Intergenic
1195462693 X:105145432-105145454 TTGAGTACACAGAAGGAGGCAGG + Intronic
1195882911 X:109611320-109611342 TTTAGGAGAGTAGAGGAGGAGGG + Intergenic
1195924430 X:110011606-110011628 TCAAGTAGACAGGAAGAGGATGG + Intronic
1196861707 X:120034792-120034814 TTTAGTAGAGACGAGGAGGGGGG + Intergenic
1198047823 X:132920191-132920213 TTCAGGAGACAAGAAGAGGAAGG - Intronic
1199456367 X:148033828-148033850 TTAAGTAGAGAGGAGGAGGATGG + Intergenic
1200105198 X:153708218-153708240 TTGAGTAAACCAGAGAAGGCAGG + Intronic
1201279986 Y:12333626-12333648 TTGTTTAGAAAACAGGAGGAAGG - Intergenic
1201701460 Y:16886852-16886874 TTGAGTAAAGAAATGGAGGAAGG - Intergenic