ID: 1092069180

View in Genome Browser
Species Human (GRCh38)
Location 12:5618860-5618882
Sequence GATGATACTCTGCTGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092069180_1092069186 12 Left 1092069180 12:5618860-5618882 CCTGTCAGCAGCAGAGTATCATC 0: 1
1: 0
2: 2
3: 13
4: 116
Right 1092069186 12:5618895-5618917 GCAGAAAGAGTCTTAGGGAAAGG 0: 1
1: 0
2: 2
3: 25
4: 278
1092069180_1092069181 -10 Left 1092069180 12:5618860-5618882 CCTGTCAGCAGCAGAGTATCATC 0: 1
1: 0
2: 2
3: 13
4: 116
Right 1092069181 12:5618873-5618895 GAGTATCATCTCCCGTCTCATGG 0: 1
1: 0
2: 0
3: 9
4: 72
1092069180_1092069185 7 Left 1092069180 12:5618860-5618882 CCTGTCAGCAGCAGAGTATCATC 0: 1
1: 0
2: 2
3: 13
4: 116
Right 1092069185 12:5618890-5618912 TCATGGCAGAAAGAGTCTTAGGG 0: 1
1: 1
2: 0
3: 11
4: 189
1092069180_1092069184 6 Left 1092069180 12:5618860-5618882 CCTGTCAGCAGCAGAGTATCATC 0: 1
1: 0
2: 2
3: 13
4: 116
Right 1092069184 12:5618889-5618911 CTCATGGCAGAAAGAGTCTTAGG 0: 1
1: 1
2: 0
3: 17
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092069180 Original CRISPR GATGATACTCTGCTGCTGAC AGG (reversed) Intronic
900998690 1:6136586-6136608 GATTACAAGCTGCTGCTGACAGG - Exonic
904306894 1:29595621-29595643 CATGAAACTCTGCTGTAGACTGG - Intergenic
906157374 1:43621676-43621698 CATGTTTCTCTGCTCCTGACTGG - Intronic
907477788 1:54717628-54717650 GATAGTACTGTGCTGCTGCCCGG - Exonic
908038029 1:60076732-60076754 GCTTATAGTCTGCTGTTGACTGG + Intergenic
909998968 1:82318869-82318891 GATGATACTCAGTTGTTTACTGG + Intergenic
918500478 1:185189351-185189373 AATGTTAATCAGCTGCTGACAGG - Intronic
922447101 1:225706825-225706847 GATGATACATTGATGCTGAGGGG + Intergenic
924470943 1:244342081-244342103 AATGATCTCCTGCTGCTGACGGG + Intergenic
1067063599 10:43090762-43090784 GAGGAACCTCTGCTCCTGACCGG - Intronic
1071181949 10:82996637-82996659 GATGGTATTCAGCTGCTGAGGGG - Intergenic
1078361748 11:10674687-10674709 GTGGCTTCTCTGCTGCTGACAGG + Intronic
1080329388 11:31117958-31117980 CATCATACTCAGCTACTGACAGG - Intronic
1081462329 11:43283353-43283375 GCTGATACACTGCAGCTGTCAGG + Intergenic
1081649855 11:44816646-44816668 GATGAGAAGCTGGTGCTGACTGG + Intronic
1092069180 12:5618860-5618882 GATGATACTCTGCTGCTGACAGG - Intronic
1096321642 12:50619362-50619384 AGTTGTACTCTGCTGCTGACTGG - Intronic
1096327277 12:50675334-50675356 GTAGATACTCTGCTACTGACAGG - Exonic
1098250070 12:68560383-68560405 GAGGATGCTCCCCTGCTGACTGG + Intergenic
1099942754 12:89209054-89209076 AATCATACTCTGCAGCAGACTGG + Intergenic
1104740462 12:131168421-131168443 GATGATACTCTGCAGCCTGCAGG - Intergenic
1105210305 13:18253417-18253439 TATGCTGCTCTGCTGCTCACAGG + Intergenic
1106269498 13:28139142-28139164 GATGAGGCCCTGCTGCCGACGGG + Intronic
1107651146 13:42546502-42546524 GATGAAACTTCCCTGCTGACAGG + Intergenic
1113003507 13:105671905-105671927 TATGATACCCTGCTGCTCTCAGG - Intergenic
1121629303 14:95410921-95410943 GTTGGAACTCTGCTGCTGATGGG - Intronic
1124406765 15:29399680-29399702 GGTAATAGTCTGCTGTTGACTGG + Intronic
1129530040 15:76258376-76258398 GATGCTTCCCTGCAGCTGACCGG - Intronic
1137887343 16:52119132-52119154 GGTGAGACTCTGCTGGGGACTGG - Intergenic
1142512026 17:402099-402121 GGTGATACCCAGCTGCTGAGAGG + Intergenic
1143593534 17:7900320-7900342 GATCATAAGTTGCTGCTGACAGG + Exonic
1145360009 17:22204202-22204224 GATGAGCCTCTGCTGGTCACAGG - Exonic
1145385453 17:22408976-22408998 GATCATTCTCTGCTGCAGCCAGG + Intergenic
1147977819 17:44258141-44258163 GATGACCCTCTGCAGCAGACAGG - Exonic
1148856775 17:50583243-50583265 GATGATCCTTTGCAGCTGACTGG + Intronic
1151206213 17:72509451-72509473 GGGGATACTCTGCTCCTGAAGGG + Intergenic
1155343086 18:24832293-24832315 GATTAAACTCTACTGCTGAATGG - Intergenic
1161610589 19:5240241-5240263 GATGATACTCTCCTGCCGCGGGG + Exonic
1163987638 19:20968397-20968419 GATGTTACTCTTCTTCTGCCTGG + Intergenic
929552404 2:42902996-42903018 GCGGATACTCTGCTTCTCACAGG - Intergenic
932315630 2:70780145-70780167 CATGAGAATCTGCTGATGACAGG - Intronic
933303130 2:80565390-80565412 GATGATACGGGGCTGCTGAGGGG + Intronic
941714215 2:168746514-168746536 GATGAGACTCTACTGATGTCTGG + Intronic
942516315 2:176757167-176757189 GCTGATAGTCTACTGTTGACTGG + Intergenic
943226785 2:185188149-185188171 GATGAGACTCTGAGGCTTACTGG - Intergenic
944132714 2:196363967-196363989 GATGATACTCTATTCCTGCCTGG - Intronic
947111418 2:226723160-226723182 GATGATACTCTGCAGAGGTCTGG - Intergenic
947569458 2:231220804-231220826 TATGATGCTCTGCTAATGACAGG - Intronic
1171504191 20:25620248-25620270 GATGATACTTTGTGTCTGACTGG + Intronic
1173398496 20:42702985-42703007 GATCATACCCTGCTGCTGGCAGG - Intronic
1178552498 21:33552512-33552534 CGTCATACTCTGCTGCTGACCGG + Exonic
1180241424 21:46509262-46509284 GAGGACACTCTGCTGTTCACAGG - Exonic
1180765950 22:18345986-18346008 TATGCTGCTCTGCTGCTCACAGG - Intergenic
1180780363 22:18516392-18516414 TATGCTGCTCTGCTGCTCACAGG + Exonic
1180813079 22:18773713-18773735 TATGCTGCTCTGCTGCTCACAGG + Intergenic
1180893614 22:19310661-19310683 TATAAAACTCTGCTTCTGACAGG + Intergenic
1181199256 22:21208029-21208051 TATGCTGCTCTGCTGCTCACAGG + Exonic
1182740158 22:32561754-32561776 GAATCTACTCTGCTTCTGACTGG + Intronic
1203227569 22_KI270731v1_random:86877-86899 TATGCTGCTCTGCTGCTCACAGG - Intergenic
950413668 3:12855827-12855849 GATGTTCCTATCCTGCTGACGGG + Intronic
953364669 3:42333586-42333608 GATGTTACTCTACTGCTTTCTGG + Intergenic
954622067 3:52002070-52002092 GAAGATGCTCTGCTGGTGAGTGG - Intergenic
963309968 3:143699469-143699491 CATGCTACACTGCTGCTGCCAGG - Intronic
963746043 3:149126140-149126162 AGTGATACAATGCTGCTGACGGG + Intergenic
964479498 3:157127659-157127681 GATGCTACCCTGCTGCTGGCGGG - Intergenic
968236392 3:197032490-197032512 GATGTTACGCTCTTGCTGACTGG + Intergenic
968236420 3:197032790-197032812 GATGTTACACTCTTGCTGACTGG + Intergenic
968236448 3:197033090-197033112 GATGTTACACTCTTGCTGACTGG + Intergenic
968236452 3:197033150-197033172 GATGTTACACTCTTGCTGACGGG + Intergenic
968236470 3:197033330-197033352 GATGTTACGCTCTTGCTGACTGG + Intergenic
968236475 3:197033390-197033412 GATGTTACACTCTTGCTGACTGG + Intergenic
968236481 3:197033450-197033472 GATGTTACACTCTTGCTGACTGG + Intergenic
968236487 3:197033510-197033532 GATGTTACACTCTTGCTGACGGG + Intergenic
968236491 3:197033570-197033592 GATGTTACTCTCTTGCTGACTGG + Intergenic
968236508 3:197033750-197033772 GATGTTACTCTCTTGCTGACTGG + Intergenic
968236511 3:197033810-197033832 GATGTTACACTCTTGCTGACTGG + Intergenic
968236523 3:197033988-197034010 GATGTTACACTCTTGCTGACTGG + Intergenic
968236529 3:197034046-197034068 GATGTTACACTCTTGCTGACTGG + Intergenic
968236543 3:197034166-197034188 GATGTTACTCTCCTGCTGACGGG + Intergenic
968236549 3:197034226-197034248 GATGTTACGCTCTTGCTGACTGG + Intergenic
968236555 3:197034286-197034308 GATGTTACTCTCTTGCTGACTGG + Intergenic
968236570 3:197034406-197034428 GATGTTACTCTCCTGCTGACGGG + Intergenic
968236576 3:197034466-197034488 GATGTTACGCTCTTGCTGACTGG + Intergenic
968236582 3:197034526-197034548 GATGTTACTCTCTTGCTGACTGG + Intergenic
968236586 3:197034586-197034608 GATGTTACACTCTTGCTGACGGG + Intergenic
968236598 3:197034706-197034728 GATGTTACACTCTTGCTGACTGG + Intergenic
968236601 3:197034766-197034788 GATGTTACACTCTTGCTGACTGG + Intergenic
968236604 3:197034826-197034848 GATGTTACGCTCTTGCTGACTGG + Intergenic
968236608 3:197034886-197034908 GATGTTACACTCTTGCTGACGGG + Intergenic
968236612 3:197034946-197034968 GATGTTATGCTGTTGCTGACTGG + Intergenic
969688394 4:8689696-8689718 GATGGTACTCTTCCTCTGACAGG + Intergenic
970628347 4:17914577-17914599 AATGCTTCTCAGCTGCTGACTGG + Intronic
974019879 4:56683469-56683491 GATGAGACTCTGTTGATGCCAGG - Intergenic
985999759 5:3621095-3621117 GATAATTCTCTGCTGCAGAAAGG - Intergenic
986151486 5:5133895-5133917 GAAGAGACTCTGCTGCTTCCTGG - Intergenic
986192138 5:5507464-5507486 GATGCTTATCTGCTGCTGGCAGG + Intergenic
988885757 5:35556321-35556343 GATGGAACTCTGCTGCTTCCAGG - Intergenic
989336584 5:40324333-40324355 AATGATCCCCTGCTGCTGTCTGG + Intergenic
991337761 5:65568497-65568519 GATGTTACTCTCCTGCTCACAGG - Intronic
991531603 5:67621329-67621351 GATGTCACTCTGCTACTTACTGG - Intergenic
995133239 5:108652871-108652893 GATGATACTTTCCTGCAGACTGG + Intergenic
995938686 5:117551234-117551256 AATGAAATTCTGCTGCTGAGGGG - Intergenic
996219273 5:120909819-120909841 CATGATAGTCTGCTGCAGACTGG + Intergenic
1001924611 5:175627154-175627176 CCTGGTGCTCTGCTGCTGACTGG + Intergenic
1002589010 5:180275339-180275361 GATGATAATCTGAAGCTGAGTGG + Intronic
1003534326 6:6962980-6963002 GATGTTTCTCTGCTGCACACAGG - Intergenic
1005262280 6:24073817-24073839 GCTTATACTCTGCTGCTGGTGGG - Intergenic
1007768697 6:44176793-44176815 GATGCAAGTGTGCTGCTGACGGG + Intronic
1011772495 6:90690606-90690628 GATCATCCTCAGCTACTGACAGG - Intergenic
1013378536 6:109543260-109543282 TATGATAAACTGCTGCTTACCGG + Intronic
1017097879 6:150820921-150820943 GAAGCTGCTCTGCTACTGACAGG + Intronic
1018787664 6:167121050-167121072 ATTGAGACCCTGCTGCTGACTGG - Intergenic
1031057284 7:117006325-117006347 CATGCTACACTGCTACTGACTGG - Intronic
1031112092 7:117623290-117623312 CATGAGACTTTGCTGCTGGCAGG + Intronic
1031378669 7:121059012-121059034 CATGTTACTATTCTGCTGACTGG - Intronic
1033365206 7:140667884-140667906 AAAGATACTCTGTTGCTCACTGG + Intronic
1035021004 7:155800421-155800443 GGTGCAACTCTGCTGGTGACTGG - Exonic
1037279083 8:17215520-17215542 AATGATTTTCTGCTGCTAACAGG - Intronic
1039581597 8:38671266-38671288 GTTCATACTCTCCTGCTAACGGG - Intergenic
1044386684 8:91597528-91597550 AACCATACTGTGCTGCTGACTGG - Intergenic
1046920380 8:119721609-119721631 GATGTTCATCTGCTGCTGAGTGG - Intergenic
1050528757 9:6569113-6569135 GATGATACACTGATACTGAAAGG - Intronic
1053222711 9:36325447-36325469 GATGAGACTCTGGGGCTGCCTGG + Intergenic
1053494179 9:38537700-38537722 GAGGTTATTCTGGTGCTGACTGG + Intergenic
1055804351 9:80076244-80076266 AATGAGACTCTGCTGGTGTCAGG - Intergenic
1056226439 9:84500229-84500251 GATGATATTCAGCTGGTGAAAGG + Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1203656086 Un_KI270752v1:26115-26137 GATGATACTCTGATACAGATAGG - Intergenic
1192247179 X:69383361-69383383 GATGATGCTTTGCTTCTGAATGG - Intergenic
1195146985 X:102027570-102027592 GGTGATACTTTGCTGATGACAGG - Intergenic
1195222549 X:102760335-102760357 CTTGCTTCTCTGCTGCTGACAGG + Intergenic
1201711318 Y:16996029-16996051 GATGATATCCTGCAGGTGACAGG + Intergenic