ID: 1092071591

View in Genome Browser
Species Human (GRCh38)
Location 12:5635942-5635964
Sequence CTTGATAAGTAGAGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092071586_1092071591 16 Left 1092071586 12:5635903-5635925 CCATTGAAGGTACCTGAGCTGAG 0: 1
1: 0
2: 0
3: 18
4: 146
Right 1092071591 12:5635942-5635964 CTTGATAAGTAGAGGCAAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 230
1092071589_1092071591 4 Left 1092071589 12:5635915-5635937 CCTGAGCTGAGAAGGGATGAGTT 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1092071591 12:5635942-5635964 CTTGATAAGTAGAGGCAAGAAGG 0: 1
1: 0
2: 1
3: 16
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092071591 Original CRISPR CTTGATAAGTAGAGGCAAGA AGG Intronic
900110393 1:1003040-1003062 CTTGCTGAGCAGAGGCAGGAGGG + Intergenic
901584038 1:10271973-10271995 GTCGATAAGTTGAGGGAAGAAGG + Intronic
904374945 1:30074790-30074812 CTTAAAAGTTAGAGGCAAGATGG - Intergenic
905275434 1:36814748-36814770 CTAGATAAGTGGAGGGCAGATGG - Intronic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
906755437 1:48309968-48309990 CTTGATTAGAAAAGACAAGAAGG - Intronic
906977009 1:50586608-50586630 CGTGAGAAGTAGAGTTAAGATGG - Intronic
907332505 1:53680232-53680254 CTTCATAAGGAAAGGCAAGGAGG + Intronic
908639220 1:66203832-66203854 CTTGACAAGTTGAGAGAAGAAGG - Intronic
908924731 1:69240690-69240712 TTTATAAAGTAGAGGCAAGAAGG + Intergenic
909471133 1:76029661-76029683 CTTGATAAGTAAACACAACATGG - Intergenic
909512361 1:76468848-76468870 CTTATGAAGTAGAGGAAAGAAGG + Intronic
909514039 1:76487710-76487732 TTTGACAAGTAGAGAGAAGAAGG - Intronic
909664795 1:78121147-78121169 AGTGACAACTAGAGGCAAGAAGG + Intronic
910484667 1:87700169-87700191 CTTCAGAAGCTGAGGCAAGAGGG + Intergenic
911806591 1:102217147-102217169 GTTGAAAAGAAGTGGCAAGAAGG - Intergenic
913124607 1:115773356-115773378 CTTGTGAAACAGAGGCAAGAGGG + Intergenic
914562579 1:148835419-148835441 TTTGACAAGTTGAGGGAAGAAGG - Intronic
914610251 1:149294803-149294825 TTTGACAAGTTGAGGGAAGAAGG + Intergenic
914930089 1:151923156-151923178 CTTGGAGGGTAGAGGCAAGATGG + Intergenic
915631209 1:157155167-157155189 CCTGATAAGTAGAGGTCAGTGGG - Intergenic
915640976 1:157225901-157225923 CTTGAAAGCTAGAAGCAAGAAGG + Intergenic
915668585 1:157467394-157467416 CTTGAAAGTTAGAAGCAAGATGG - Intergenic
916005722 1:160658348-160658370 CTTCATATCTAGGGGCAAGAAGG + Intergenic
916015796 1:160748919-160748941 ATTGATAAATAGATGCAAGAAGG + Intronic
916184292 1:162115746-162115768 CTTGAAAACTAGAGGCAGGGAGG + Intronic
917019269 1:170568867-170568889 CTAGATTGGTAGGGGCAAGATGG + Intergenic
918065797 1:181100869-181100891 GTTGATATCTAGAGGGAAGAGGG + Intergenic
918554523 1:185783330-185783352 TTTGATAAGTTGAGAGAAGAAGG - Intronic
918990910 1:191696136-191696158 CTTGGAAGGTAGAAGCAAGATGG - Intergenic
919842569 1:201619826-201619848 CTGGAGAAGCAGAGGCAAGCTGG + Intergenic
921479517 1:215647742-215647764 ATGGATACGTAGAGTCAAGACGG + Intronic
921891821 1:220361253-220361275 CTTTATAAGAAGAGGCAATTTGG + Intergenic
1063040672 10:2334043-2334065 CTCGAAAAGTAGAGGCCACATGG - Intergenic
1063260988 10:4389269-4389291 ATTGATATGTAAAGGGAAGATGG - Intergenic
1068297884 10:55098565-55098587 CTTGGCAAATAGAGGGAAGATGG - Intronic
1068751318 10:60595793-60595815 CTTGATAATTAAAAGCAAGATGG + Intronic
1069112668 10:64466050-64466072 CTGAATATTTAGAGGCAAGAAGG + Intergenic
1069366435 10:67699086-67699108 CTTGAAAAGGTGAGGGAAGAAGG - Intergenic
1069725305 10:70573724-70573746 CAGGCTACGTAGAGGCAAGAGGG - Intergenic
1074284615 10:112086397-112086419 CTGGAGAAGCTGAGGCAAGAAGG + Intergenic
1076381783 10:130028523-130028545 CTTGAGAAGTAAAGGCAAAGAGG + Intergenic
1078610087 11:12812228-12812250 CTGAATAAGTGGTGGCAAGAGGG - Intronic
1078977819 11:16497474-16497496 TTTGATAAGTTGAGAGAAGAAGG + Intronic
1081235509 11:40643024-40643046 CTTGAAAAGTAGAGTGAAGAAGG + Intronic
1081530592 11:43956355-43956377 CTTGATTAACAAAGGCAAGAGGG + Intergenic
1082558038 11:54586299-54586321 TTTGATGAGTTGAGACAAGAAGG - Intergenic
1085823842 11:79821703-79821725 TTTGACATGTAGATGCAAGAGGG - Intergenic
1087655758 11:100921022-100921044 CTGAAAAAGTAGAGGCACGAAGG - Intronic
1088109453 11:106245545-106245567 CTTGATACTGAGAGGCATGAGGG + Intergenic
1088823198 11:113474221-113474243 CTTGAAGAGCAGAGGTAAGAGGG - Intronic
1089028709 11:115299701-115299723 CTTAAGAAGCAGAAGCAAGACGG + Intronic
1089040378 11:115442965-115442987 TTTTATAAGTAGATACAAGAGGG + Intronic
1090322403 11:125858491-125858513 TTTGACAAGTAGAGAGAAGAAGG + Intergenic
1092071591 12:5635942-5635964 CTTGATAAGTAGAGGCAAGAAGG + Intronic
1096348995 12:50878468-50878490 CTTGGAAGGTTGAGGCAAGAAGG + Intronic
1096390953 12:51228785-51228807 CTTGAGAGGCTGAGGCAAGAGGG - Intergenic
1098421598 12:70304186-70304208 TTTGATGAGTTGAGACAAGAAGG - Intronic
1101679656 12:106953294-106953316 CTTGGGAAGTTGAGGCAGGAAGG - Intergenic
1104300200 12:127558004-127558026 CTTCTTTAGTAGAGGCAGGATGG - Intergenic
1106461296 13:29972702-29972724 CTTGAAGATTAGATGCAAGATGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107090390 13:36473273-36473295 TTTGATAAGTTGAGAGAAGAAGG - Intergenic
1107491904 13:40888103-40888125 TTTGATAAGTTGAGAGAAGAAGG + Intergenic
1109014281 13:56989087-56989109 CTTGATTTGTAAAGACAAGAAGG + Intergenic
1110256658 13:73440655-73440677 TTTGATAAGGACAGGCAAGTAGG + Intergenic
1111701013 13:91689058-91689080 CTTGGGAAGTTGAGGCAGGAGGG + Intronic
1111917895 13:94380911-94380933 TTTGATGAGTAGAGGCCAGCTGG + Intronic
1112240472 13:97676660-97676682 CCTTATAAGAAGAGGCCAGAGGG - Intergenic
1113336168 13:109378222-109378244 CTTTAAAAGTGGAGGCAAGCCGG + Intergenic
1113812518 13:113151177-113151199 CTTCATAAGTAAAGGCAAGTGGG + Intergenic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1117664202 14:58039328-58039350 TCTGATAAACAGAGGCAAGATGG - Intronic
1117671948 14:58117057-58117079 CTGGAGAAGTGGAGGCAGGAGGG - Intronic
1118745364 14:68769302-68769324 CGTGATAAGTACAGAAAAGAGGG + Intergenic
1118958235 14:70502457-70502479 TTTGATAAGTTGAGAGAAGAAGG + Intergenic
1119038078 14:71247382-71247404 ATTGATGAGTACAGGGAAGAGGG - Intergenic
1120213542 14:81658171-81658193 CTTGGAAAGTAGAGGGTAGAGGG + Intergenic
1123681187 15:22765437-22765459 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1124230748 15:27944267-27944289 CTTGAAGGCTAGAGGCAAGAAGG - Intronic
1124333400 15:28839899-28839921 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1124609367 15:31197733-31197755 CTTGAGAATTCAAGGCAAGAGGG + Intergenic
1128048622 15:64642289-64642311 CTTGAGAAGTTGAGGTGAGAGGG - Intronic
1130000828 15:80045216-80045238 ATTGATAAGTAAATACAAGATGG + Intergenic
1130777988 15:87005674-87005696 TTTGACAAGTAGAGAAAAGAAGG - Intronic
1131768946 15:95713835-95713857 CTAGAGAACTAAAGGCAAGAAGG + Intergenic
1132860190 16:2066956-2066978 TTTGAAAAGTAGAGGCAGGCCGG - Intronic
1134646582 16:15872591-15872613 CTTGGGAAGCTGAGGCAAGAAGG + Intronic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1140137676 16:72222213-72222235 CTTGAGAAGGTGAGGCAGGAAGG - Intergenic
1140703398 16:77603426-77603448 CTTGAAAGATAAAGGCAAGAGGG + Intergenic
1141029172 16:80572870-80572892 CTAGAGAAGTGGGGGCAAGAGGG - Intergenic
1144036485 17:11370612-11370634 CTTGAGGAGCACAGGCAAGATGG - Intronic
1144097803 17:11917505-11917527 CTTGATCAGAGAAGGCAAGAAGG - Intronic
1145716714 17:27029740-27029762 TTTGATGAGTAGAGAGAAGAAGG + Intergenic
1146105534 17:30032444-30032466 CTTGAAAAATAGATACAAGAAGG + Intronic
1147805102 17:43125622-43125644 CTGGAAGAGTAGAGGCTAGAGGG - Intergenic
1149550120 17:57533681-57533703 CTTGATCAGGAGAGGGCAGAGGG + Intronic
1150042503 17:61879101-61879123 CTTGATTGGTAAAGGCAAGAGGG - Intronic
1151025597 17:70672670-70672692 CTTGACAAGTAGAGGCACATGGG - Intergenic
1156819691 18:41357280-41357302 CTTGAAAAGTAGAGAAAAAATGG - Intergenic
1158684910 18:59604881-59604903 CTTGATAGGTAGGGTCAAAATGG + Intronic
1158719530 18:59911912-59911934 CTTGCTAAGTAGAGTTAAGAGGG - Intergenic
1159099459 18:63941507-63941529 TTTGATAAGTTGAGAGAAGAAGG + Intergenic
1163199236 19:15751492-15751514 ATTGAAAAGTAGTGACAAGAGGG - Intergenic
1164111679 19:22167689-22167711 TTTTATAATTAGAGACAAGAAGG - Intergenic
1164500342 19:28814455-28814477 CTTTATAAGAAGAGGAGAGAGGG - Intergenic
925744092 2:7030010-7030032 CATGATAAGTGGAGACATGAGGG - Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926151663 2:10428978-10429000 CTTGCTACAAAGAGGCAAGACGG + Intergenic
926517154 2:13861898-13861920 AAGGATAATTAGAGGCAAGAGGG + Intergenic
928825958 2:35421245-35421267 CTTTATAAGCAGAGGAAATATGG - Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929260984 2:39866376-39866398 CTTGAGAACTACAAGCAAGAAGG - Intergenic
930280657 2:49365350-49365372 CTTTATAAGTATTAGCAAGAAGG - Intergenic
931416614 2:62087456-62087478 CTTGATAAGTGGGGGCATGGTGG + Intronic
936717288 2:115202511-115202533 CTCGAAAAGTAGAGGCAAGTAGG - Intronic
937006277 2:118519657-118519679 CATGGTAAGCAGAGCCAAGAGGG - Intergenic
943851660 2:192730812-192730834 ATTAATAAGTAGAAGCATGAAGG + Intergenic
943931496 2:193859505-193859527 CCTGAAATATAGAGGCAAGATGG - Intergenic
945542250 2:211103177-211103199 ATTGATAAGAAAAGGCAAGAAGG + Intergenic
947889121 2:233600917-233600939 CTTGAAGGTTAGAGGCAAGATGG + Intergenic
1171814024 20:29767696-29767718 CTTGGTCAGTGGAGCCAAGAGGG + Intergenic
1174075842 20:47936008-47936030 TTTGATTAGTAGATGCAAAACGG - Intergenic
1175092474 20:56515946-56515968 TTTGAAAAGCACAGGCAAGAAGG - Intronic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1177549437 21:22600986-22601008 CTTGGAAGGTAGAAGCAAGATGG - Intergenic
1180317477 22:11288298-11288320 CTTGGTCAGTGGAGCCAAGAGGG + Intergenic
949725988 3:7045404-7045426 AAGGATAAGAAGAGGCAAGAGGG + Intronic
950024984 3:9813969-9813991 CTTGGTAAGTGAAGGCAGGAAGG + Intronic
950511769 3:13433461-13433483 CTTGGAAATTAGAAGCAAGATGG - Intergenic
951072461 3:18347700-18347722 CTTAATAAGTAGAGATAGGATGG - Intronic
951806492 3:26649928-26649950 CTGGATAAGTAGAGGGAAAGAGG - Intronic
953799414 3:46010910-46010932 CTTGAAGATTAGAAGCAAGATGG - Intergenic
954717117 3:52532459-52532481 CTTGACCAGTAAAGGCAGGATGG - Intronic
957976286 3:87448838-87448860 CTTGATATGCAGAGGTAAGAAGG + Intergenic
958132999 3:89453872-89453894 TTTTATAATTAGAGGAAAGAAGG - Intronic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959615586 3:108343651-108343673 CTTGATATGTAGATACAAGTAGG + Intronic
959821866 3:110744918-110744940 TTTGATAAATGGAGGCAATAAGG - Intergenic
961076777 3:123990191-123990213 CTTGAAAAGTAGTTGCAATAGGG + Intronic
961646933 3:128397717-128397739 CTTGATGAGTAGAGGCCAGCTGG - Intronic
963059296 3:141211958-141211980 CTTGGTGGGTAGAAGCAAGATGG - Intergenic
964161595 3:153652147-153652169 CATGATTTGGAGAGGCAAGAGGG - Intergenic
964173483 3:153797942-153797964 CTTGATGAGTTGAGAGAAGAAGG + Intergenic
964357233 3:155862002-155862024 CTTGATGGTCAGAGGCAAGATGG - Intergenic
965761618 3:172083684-172083706 CTGGATAATTAGAGTGAAGATGG + Intronic
967410681 3:189163829-189163851 CTAGACAAGCAGAGCCAAGAGGG - Intronic
967676321 3:192302857-192302879 TATGATAAGTAAAGGCAAGAAGG + Intronic
968263525 3:197344066-197344088 CGGGATGAGTAGAGGAAAGAAGG - Intergenic
968300923 3:197613883-197613905 CTTGAAAGCTAAAGGCAAGAGGG + Intergenic
968388741 4:170831-170853 TTTGATGAGTTGAGACAAGAAGG - Intergenic
969030664 4:4210519-4210541 CTTTATAAGAAGAGGAGAGAAGG - Intronic
970896335 4:21108582-21108604 TTTGATAAGTTGAGAGAAGATGG - Intronic
972032991 4:34486081-34486103 CTTGGGAAGCAGAGGCAGGAGGG - Intergenic
972317772 4:37943819-37943841 TTTGATGAGTTGAGGGAAGAAGG - Intronic
972677548 4:41275404-41275426 CTTGATGAGTTGAGAGAAGAAGG - Intergenic
973546648 4:51989391-51989413 CTTGATGAGTTGAGAAAAGAAGG - Intergenic
975204701 4:71631345-71631367 CTTGGAAATTAGAAGCAAGATGG + Intergenic
975778624 4:77818136-77818158 CAAGATAACTAGAGGCAATACGG + Intronic
975833713 4:78398490-78398512 GTTGATAAGTACAGCCAAGATGG + Intronic
978264027 4:106800682-106800704 CTTGTTGAGTAGAGGCATGGAGG + Intergenic
980871876 4:138621525-138621547 CTTGATGGTTAGAAGCAAGATGG - Intergenic
982297094 4:153840303-153840325 CTTGATAAATCCAGACAAGATGG - Intergenic
982479101 4:155887270-155887292 TGTGATAAGTAGAGGGTAGAGGG - Intronic
983173613 4:164563132-164563154 CTTGATCGGTGGAGCCAAGATGG + Intergenic
986212336 5:5685877-5685899 CTTGAAAGCTAAAGGCAAGAAGG - Intergenic
986392176 5:7297431-7297453 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
988304395 5:29476075-29476097 CTTGATAAGGCAAGGAAAGAAGG - Intergenic
988399103 5:30738378-30738400 GGTGATAAGTTGAGGCAAAAAGG - Intergenic
988635609 5:32980250-32980272 CTTATTAAGTAGAGACATGAAGG + Intergenic
989953668 5:50331233-50331255 CTTGATAAGTTGAGAGAAGAAGG + Intergenic
990856531 5:60273625-60273647 CCAGAGAAGTAGAGGCAAAATGG + Intronic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
992042850 5:72853459-72853481 CTTGTTAAGTAGTGGCAAGAGGG + Intronic
992883106 5:81130314-81130336 TTTCAGAAGTAGAGGCAATAAGG + Intronic
993008710 5:82456525-82456547 TTTGATAAGTTGAGAGAAGAAGG - Intergenic
994224721 5:97239252-97239274 TTTGATGAGTAGAGAGAAGAAGG - Intergenic
994664165 5:102688410-102688432 TTTGACAAGTAGAGAGAAGAAGG - Intergenic
995337569 5:111018254-111018276 CTTGATAAATGGAGGCAACAAGG - Intergenic
996503321 5:124240819-124240841 CTTCATATGGAGAGGAAAGATGG + Intergenic
1000089563 5:157918439-157918461 CTTGGAGATTAGAGGCAAGATGG + Intergenic
1001251358 5:170149333-170149355 CCTGTAAAATAGAGGCAAGAAGG - Intergenic
1002110636 5:176908404-176908426 CAAGATAAATAGAGGGAAGAGGG + Intronic
1003649679 6:7948163-7948185 TTTGACAAGTTGAGGGAAGAAGG - Intronic
1005089761 6:22043876-22043898 CTTGATAAACAGAGTCAAGGTGG + Intergenic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1009887894 6:69645948-69645970 CTTGATGAGTTCCGGCAAGATGG + Intergenic
1010132992 6:72517238-72517260 TTTGAAAAGTGGAGGAAAGAAGG - Intergenic
1010804392 6:80217841-80217863 CTTGGTAACTAGAGCGAAGAAGG + Intronic
1011338617 6:86287305-86287327 CTTAAAGATTAGAGGCAAGATGG - Intergenic
1011376615 6:86694361-86694383 TTTGATGAGTTGAGGGAAGAAGG - Intergenic
1014083137 6:117311333-117311355 TTTAGTAAGTAGAGGCAATATGG + Intronic
1016028640 6:139314787-139314809 CTTGAGGATTAGAAGCAAGATGG - Intergenic
1016775032 6:147895973-147895995 TTTGATTAGTGAAGGCAAGAGGG + Intergenic
1017409042 6:154149836-154149858 CTGGAATAGTAGAGGCCAGATGG - Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1021123391 7:16822435-16822457 CTTGATAAGGATCAGCAAGATGG + Intronic
1022853676 7:34293981-34294003 ACTGATAAGTAGAGGGAAAATGG - Intergenic
1024934929 7:54702266-54702288 CTTTATTCGTAGAGGCCAGATGG + Intergenic
1027329290 7:77074799-77074821 CTTGGTGATTAGAAGCAAGATGG - Intergenic
1027613217 7:80388769-80388791 CTTGTTAAGATGAAGCAAGAAGG + Intronic
1027735981 7:81933332-81933354 CTTGGTGGTTAGAGGCAAGATGG + Intergenic
1029786475 7:102796567-102796589 CTTGGTGATTAGAAGCAAGATGG + Intronic
1031838111 7:126703665-126703687 CTTGAAAGATTGAGGCAAGAGGG - Intronic
1033106976 7:138536200-138536222 CTTGATGAGTTGAGAGAAGAAGG - Intronic
1033414248 7:141148217-141148239 CTTGTAAAAGAGAGGCAAGAAGG - Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034453032 7:151148028-151148050 CTTTGTAAAGAGAGGCAAGATGG + Intergenic
1036536317 8:9655900-9655922 CTTGATGAGTTGAGAGAAGAAGG + Intronic
1039057929 8:33551278-33551300 CCTGATAGGAAGAGGCAAGGAGG - Intronic
1041981397 8:63865143-63865165 CTTGAAAGGTGGAGACAAGAAGG - Intergenic
1044884576 8:96763101-96763123 CTTTATAAGAAGAGGAAAGTTGG - Intronic
1045419639 8:102001033-102001055 TTTGATGAGTAGAGAGAAGAAGG + Intronic
1045527153 8:102950804-102950826 CTTGGGAAGCTGAGGCAAGAGGG - Intronic
1046683009 8:117192573-117192595 TTTGATGAGTTGAGACAAGAAGG + Intergenic
1050049840 9:1588377-1588399 TTTGATGAGTTGAGACAAGAAGG - Intergenic
1052564416 9:30129250-30129272 CTTGATAAGAACAGGCACCATGG + Intergenic
1053282943 9:36832829-36832851 CTTGAGAGGCTGAGGCAAGAGGG + Intergenic
1053855185 9:42331324-42331346 CTTGGAAATTAGAAGCAAGATGG + Intergenic
1056376864 9:86023151-86023173 CTTGGAAAGGAGAGCCAAGAGGG - Intergenic
1057572722 9:96216614-96216636 TTTGAAAAGTATAGTCAAGAAGG - Intergenic
1058543204 9:106033581-106033603 CTTGCGAAGGAAAGGCAAGAAGG - Intergenic
1062291631 9:135797858-135797880 CTTGGGAAGCAGAGGAAAGAGGG - Intergenic
1203440957 Un_GL000219v1:8363-8385 TTTGACAAGTTGAGACAAGAAGG - Intergenic
1203365707 Un_KI270442v1:254015-254037 CTTGGTCAGTGGAGCCAAGAGGG + Intergenic
1186715996 X:12251921-12251943 CTTGTGAAGTAGAGGAAAAATGG + Intronic
1188872252 X:35387544-35387566 CTTGGAAACTAAAGGCAAGAGGG - Intergenic
1190962374 X:55265155-55265177 CCTCATAAATAGAGGGAAGAGGG + Intronic
1191602075 X:63019029-63019051 CTTGACAAGTTGAGAGAAGAAGG + Intergenic
1192203156 X:69079855-69079877 CTTGATATATAAAGCCAAGAGGG + Intergenic
1194344252 X:92743680-92743702 CTTTATAAGTAGAGGAAATTAGG - Intergenic
1194466568 X:94240995-94241017 CTGGAGGAGTTGAGGCAAGATGG - Intergenic
1195203858 X:102575445-102575467 CTTGATGAGTTGAGAGAAGAAGG + Intergenic
1195343127 X:103924353-103924375 CTTGTTAAGTAGAGGAGTGAGGG - Intronic
1195440610 X:104894770-104894792 TTTGATGAGTTGAGACAAGAAGG - Intronic
1197042829 X:121960416-121960438 CTTGAAAGTTAGAAGCAAGATGG + Intergenic
1198228082 X:134664806-134664828 ATAGAGAAGTAGAGCCAAGAGGG + Intronic
1201425896 Y:13850911-13850933 TTTGATAAGTTGAGAGAAGAAGG - Intergenic
1202022345 Y:20478301-20478323 TTTGATGAGTTGAGGGAAGAAGG + Intergenic
1202241986 Y:22780640-22780662 CATGACAAGTAGAGAGAAGAAGG - Intergenic
1202269762 Y:23060468-23060490 CTTGATAAGAGCAGGCAACAAGG + Intergenic
1202394970 Y:24414384-24414406 CATGACAAGTAGAGAGAAGAAGG - Intergenic
1202422756 Y:24694214-24694236 CTTGATAAGAGCAGGCAACAAGG + Intergenic
1202448033 Y:24975872-24975894 CTTGATAAGAGCAGGCAACAAGG - Intergenic
1202475814 Y:25255708-25255730 CATGACAAGTAGAGAGAAGAAGG + Intergenic