ID: 1092074025

View in Genome Browser
Species Human (GRCh38)
Location 12:5657989-5658011
Sequence AGGCCAGCAATCTGTGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092074019_1092074025 28 Left 1092074019 12:5657938-5657960 CCTCCACATATATGTGGACTGAA 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1092074025 12:5657989-5658011 AGGCCAGCAATCTGTGAAATGGG 0: 1
1: 0
2: 1
3: 9
4: 178
1092074018_1092074025 29 Left 1092074018 12:5657937-5657959 CCCTCCACATATATGTGGACTGA 0: 1
1: 0
2: 0
3: 3
4: 146
Right 1092074025 12:5657989-5658011 AGGCCAGCAATCTGTGAAATGGG 0: 1
1: 0
2: 1
3: 9
4: 178
1092074020_1092074025 25 Left 1092074020 12:5657941-5657963 CCACATATATGTGGACTGAAACA 0: 1
1: 1
2: 3
3: 60
4: 585
Right 1092074025 12:5657989-5658011 AGGCCAGCAATCTGTGAAATGGG 0: 1
1: 0
2: 1
3: 9
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092074025 Original CRISPR AGGCCAGCAATCTGTGAAAT GGG Intronic
901880231 1:12189475-12189497 AGGTCTACCATCTGTGAAATGGG - Intronic
902465471 1:16614755-16614777 AGGCCAGGAAGCTGGTAAATAGG - Intergenic
905888666 1:41505883-41505905 AAGCCTGGAATCTGTGAAAGTGG + Intergenic
906308453 1:44736393-44736415 ATGCCATCAATATGTGAATTGGG + Intergenic
914948342 1:152086765-152086787 AGGTCAGCATGCTGTGAACTGGG + Exonic
915198497 1:154208515-154208537 AGGCAAGAACTCTGGGAAATTGG - Intronic
916511049 1:165472714-165472736 AGTCCATCAATCTGTGCAAAGGG + Intergenic
922418698 1:225444852-225444874 AGGCCTGGACTGTGTGAAATTGG + Intergenic
922948783 1:229540263-229540285 GGGCCAGCAATCTGTTTAACAGG - Intronic
1065137102 10:22682402-22682424 AGGCCAGCAATCTAAAAATTAGG + Intronic
1066300219 10:34089678-34089700 AGGCCAGCCATTTAAGAAATTGG + Intergenic
1066792213 10:39078196-39078218 AAGGAAGCTATCTGTGAAATTGG + Intergenic
1067201152 10:44172986-44173008 TGGCCCCCCATCTGTGAAATGGG + Intergenic
1067791264 10:49289498-49289520 AGGCAACCAATCTGTAAAGTTGG + Intergenic
1068132983 10:52918312-52918334 GAGCCAGCAGTGTGTGAAATAGG - Intergenic
1068526104 10:58131759-58131781 AGGCCATCTTACTGTGAAATAGG - Intergenic
1068954538 10:62810678-62810700 ACGCCAACAAGCTGGGAAATAGG + Intergenic
1070364985 10:75728138-75728160 CAGCCAGCCATCAGTGAAATGGG + Intronic
1070993685 10:80755864-80755886 AGGCCATCAATATTTAAAATAGG - Intergenic
1071153627 10:82664833-82664855 AGGCCAGAAATCAGTGACAAAGG + Intronic
1072447176 10:95509259-95509281 AGGCCAGCAAACAATGAACTAGG + Intronic
1072575441 10:96695512-96695534 AAACCAGCAGTCTGTGAAACTGG + Intronic
1074897418 10:117789432-117789454 AGGGCACCCATCTATGAAATGGG - Intergenic
1078452415 11:11450050-11450072 AGGTCAGAAATCAGAGAAATTGG + Intronic
1080259169 11:30327178-30327200 AGGCCAGGAATTTCAGAAATAGG + Intronic
1080433282 11:32217699-32217721 AGGCCAGCACTCTGAGCAAGCGG + Intergenic
1081260927 11:40959636-40959658 AGGGCAATAATCTGGGAAATTGG - Intronic
1081562481 11:44230528-44230550 AGGACATCAGTCTGTGAATTAGG - Intronic
1081631212 11:44691249-44691271 AGGCCAGTAAACTGTGATTTAGG + Intergenic
1081874657 11:46400379-46400401 ATGCCACCAAGCTGTGAAACTGG - Intronic
1085370654 11:76001452-76001474 AGGCCACTAATCAGTGAAACTGG + Intronic
1086076367 11:82857305-82857327 ATCACAGCAATCTATGAAATAGG + Intronic
1086273440 11:85096087-85096109 AAGTCAGCACTCTGTAAAATGGG + Intronic
1086883808 11:92180383-92180405 AGGCAAGCAATCTGTAAAGGAGG + Intergenic
1087942912 11:104122349-104122371 AGGCCAGAAATTTGTGCAAATGG + Intronic
1089884503 11:121806707-121806729 AGGCTACCAATTTGTAAAATTGG - Intergenic
1091289109 11:134427391-134427413 AGGCCAGGCAGCTGTGAAACAGG + Intergenic
1092074025 12:5657989-5658011 AGGCCAGCAATCTGTGAAATGGG + Intronic
1094763832 12:33568186-33568208 ATGCCAGCAATATATAAAATAGG - Intergenic
1100721762 12:97366567-97366589 AGGCCACTCAACTGTGAAATAGG - Intergenic
1102911011 12:116714140-116714162 AGGCCCTTCATCTGTGAAATGGG - Exonic
1108226957 13:48299954-48299976 GGGCCAGCAGGCTGAGAAATTGG + Intergenic
1109192673 13:59344435-59344457 AGAGCAGCCATCTGTGAAACAGG + Intergenic
1109977884 13:69865196-69865218 AGGCCTGCAATCTCTGCACTTGG - Intronic
1110757027 13:79187006-79187028 AGGCCACCAATCTGTCCATTTGG - Intergenic
1120034154 14:79676788-79676810 AGGTCAGCAAACTGTGAAGGGGG - Intronic
1120468353 14:84890648-84890670 AGGGCAGCTGTCTGTGAACTAGG - Intergenic
1121612627 14:95292082-95292104 AGTCCCCCTATCTGTGAAATAGG - Intronic
1123995391 15:25714381-25714403 ATGCCTGAAATCTGGGAAATGGG - Intronic
1126316828 15:47378720-47378742 AGTTCTGCAATCTGTGAAATGGG + Intronic
1127798336 15:62456907-62456929 AGGCCACCAAGCTGTGGGATGGG + Intronic
1127991958 15:64125972-64125994 AGGGCAGGGATCTGGGAAATGGG + Intronic
1130116095 15:81005501-81005523 GGGCCAGAAATCTGTAAATTTGG + Exonic
1131334487 15:91534820-91534842 TGACTAGCAATCTGTGAACTTGG + Intergenic
1131812921 15:96191320-96191342 AGGCCAGAATTCAGTCAAATGGG + Intergenic
1132066912 15:98738761-98738783 TGACCGGCAAACTGTGAAATGGG - Intronic
1133611694 16:7439772-7439794 AAGCAAGCAATCTGTAAATTTGG - Intronic
1133753027 16:8739393-8739415 ATGCAAGAAATTTGTGAAATAGG - Intronic
1137046935 16:35674015-35674037 ACACCAGCTATCTGTGAAAATGG + Intergenic
1137291861 16:47056947-47056969 AGGGCAGCATTCTGGGAATTAGG - Intergenic
1137839149 16:51624022-51624044 AGGCCACTAATGAGTGAAATTGG + Intergenic
1138485661 16:57341445-57341467 AGGCCCTGACTCTGTGAAATGGG - Intergenic
1139375668 16:66494968-66494990 AGGCTTCCCATCTGTGAAATGGG + Intronic
1140792766 16:78408225-78408247 AGGGCAGGAATATGTAAAATAGG - Intronic
1144764918 17:17727418-17727440 AGTCCCCCCATCTGTGAAATGGG - Intronic
1144922429 17:18775564-18775586 ATGTCATCAATCTGAGAAATGGG + Intronic
1148705288 17:49625038-49625060 GGGCCAGCAATCTGTTTAAAAGG - Intronic
1149000085 17:51748401-51748423 AGTCTAGGAATCTATGAAATTGG - Intronic
1154055390 18:11008480-11008502 AGGCAAGCAATCTGGGAACTGGG - Intronic
1156213655 18:34975636-34975658 GGGGGAGCAATGTGTGAAATGGG - Intergenic
1157533916 18:48444682-48444704 AGCCCAGCACCTTGTGAAATGGG + Intergenic
1157576347 18:48746380-48746402 AGGCCAGCAAGCTGTGACCCTGG - Intronic
1158291052 18:55943791-55943813 AGAACAGAAATCAGTGAAATAGG - Intergenic
1158730843 18:60020732-60020754 AGCCCAGCAATCTGTTTAACAGG - Intergenic
1160234495 18:77075402-77075424 AGGCCAGCAATGTGTGTGATGGG - Intronic
1165239070 19:34449003-34449025 ATGACAGCAACATGTGAAATGGG - Intronic
925098144 2:1223931-1223953 AGGCCACCCATCTGTGGAATTGG - Intronic
925952084 2:8924265-8924287 AGGCTATTAATCAGTGAAATGGG - Intronic
926132953 2:10316633-10316655 AGGCCAGCCATCAGAAAAATTGG + Intronic
928918666 2:36502495-36502517 AGGCCAGCTATCTGTATAAATGG - Intronic
932290384 2:70572284-70572306 ATGCCAGAAATCTGCCAAATAGG - Intergenic
932412568 2:71555953-71555975 AGGCCAGCTTCCTGTGGAATGGG - Exonic
933391324 2:81671834-81671856 ATGCCAGAAATTTGTAAAATGGG - Intergenic
933432214 2:82197421-82197443 AGGCCTGCTGTTTGTGAAATAGG + Intergenic
933836050 2:86246384-86246406 AAACCAGCATTCTGTGAATTAGG - Intronic
933980069 2:87542002-87542024 GGGACAGAAATCGGTGAAATCGG - Intergenic
934521668 2:95023900-95023922 GGGGCAGCAATCTCTGAAAGAGG - Intergenic
936970055 2:118168539-118168561 AGGGCAGCCATCTATGCAATAGG + Intergenic
940629377 2:156218322-156218344 AGGACAGCCATCTGTGAACCAGG + Intergenic
942192047 2:173479961-173479983 AGGAGAGCAAGCTGGGAAATAGG + Intergenic
943137114 2:183927963-183927985 AGGCCAGGAGGCTGTGAAACAGG - Intergenic
943439314 2:187906487-187906509 AGGACAGAAATCAGTGAAATAGG + Intergenic
945247290 2:207730161-207730183 AGGACTGAAATCTGGGAAATGGG - Intronic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
946614308 2:221493145-221493167 AGGCATACATTCTGTGAAATAGG - Intronic
946638933 2:221762492-221762514 ATTCCCACAATCTGTGAAATGGG + Intergenic
947147260 2:227079686-227079708 AGGCTACCCATCTGTCAAATAGG - Intronic
1169983580 20:11415819-11415841 AGGACAGAAATCAATGAAATTGG - Intergenic
1170909344 20:20549244-20549266 AAGGCAACAATCTGTAAAATGGG + Intronic
1173025011 20:39299349-39299371 ATGCCAGGAATCTGTCACATGGG - Intergenic
1173042126 20:39474530-39474552 AGTTTAGCAATCTGTAAAATGGG + Intergenic
1173199155 20:40941629-40941651 AGCCCAGCAGTCTGTGAACTAGG + Intergenic
1173502798 20:43566072-43566094 AGGCCTTCCATCTGTGAAATGGG + Exonic
1173758296 20:45537868-45537890 AGACCAGCCATCAGTGAACTAGG + Intronic
1178600347 21:33989014-33989036 AGGCTACCATTTTGTGAAATAGG - Intergenic
1178706333 21:34876450-34876472 AGGCCAAAAATTTGTGAATTTGG - Intronic
1179113894 21:38472287-38472309 ATGCCAGCACTCTATGCAATGGG + Intronic
1180169844 21:46052335-46052357 AGGCCTTCAACCTGTGAACTGGG - Intergenic
1181137753 22:20780862-20780884 ACCCTAGCAATCTGTTAAATTGG + Intronic
1183078254 22:35440364-35440386 AGGTCACCCATCTCTGAAATGGG + Intergenic
1183351043 22:37334921-37334943 GGACCTGCCATCTGTGAAATGGG - Intergenic
1183796275 22:40121050-40121072 AGGCCAGGAATATGAAAAATTGG + Intronic
1183922832 22:41182902-41182924 AGCACATCAATCTATGAAATGGG + Intergenic
953682365 3:45049374-45049396 ATGCTGGCAATCTGTGAGATAGG - Intergenic
957027986 3:75206581-75206603 AGGACAGCTATCTATGAACTGGG + Intergenic
957112074 3:75975261-75975283 AGGCCAACAAACTATTAAATTGG - Intronic
961562990 3:127743793-127743815 AGGCCAACAAGCTGTGATCTTGG - Intronic
961619876 3:128215742-128215764 AGGTAAGCAATCTGGAAAATGGG - Intronic
961720434 3:128891134-128891156 CGGCCAGCAATTTTTAAAATAGG + Intronic
964324318 3:155530047-155530069 TGGCCAGCAATTTCTTAAATAGG + Intronic
965692653 3:171373924-171373946 AGGCTAGCACTATGTGAAAATGG - Intronic
966133616 3:176673008-176673030 AGGAGAGGAATCTCTGAAATTGG + Intergenic
966759787 3:183407742-183407764 AAGCCCGCAGGCTGTGAAATGGG - Intronic
967989758 3:195122093-195122115 AAGGCAGCCATCTGTGAACTGGG - Intronic
971695009 4:29889637-29889659 ATGACAGCAATATGTGATATAGG + Intergenic
972125518 4:35760528-35760550 AGGTCAGGTAGCTGTGAAATGGG - Intergenic
973657865 4:53068909-53068931 AGGCCAGCAAAGTGATAAATGGG + Intronic
975817575 4:78235028-78235050 AGGTCAGCAGTCTGGGAACTTGG + Intronic
980058069 4:128098262-128098284 AAACCAGCAATCAGGGAAATAGG - Exonic
981427054 4:144615786-144615808 TGGCAACCAATCTGTGAAACTGG + Intergenic
984038818 4:174703624-174703646 AGACCACAAATCTGTGAATTAGG - Intronic
986955461 5:13145188-13145210 ATGCCAGCATGCTATGAAATAGG - Intergenic
987802274 5:22714420-22714442 AGGCCAGTAATCGCTGAAAGAGG - Intronic
989296201 5:39829639-39829661 GGAACAGCCATCTGTGAAATAGG - Intergenic
995348295 5:111146324-111146346 AGGGCAGCAATCTGAGAAATAGG + Intergenic
995863384 5:116664434-116664456 AGGCCAGCAATAGGGAAAATGGG - Intergenic
996879561 5:128280275-128280297 AAGCCAGGAATCTGTGAAAATGG - Exonic
998456907 5:142280669-142280691 TGCTCAGGAATCTGTGAAATAGG + Intergenic
999984758 5:156992518-156992540 AGCCCAGAAACCTGTGAAAGGGG - Intergenic
1000668658 5:164031851-164031873 AGGACATCATTCTATGAAATGGG + Intergenic
1001135139 5:169096580-169096602 AGGACAGCAAACTGTGACTTTGG - Intronic
1001199879 5:169706456-169706478 AGGTCACCCAGCTGTGAAATGGG + Intronic
1001301337 5:170535959-170535981 AGTCTTGCCATCTGTGAAATGGG + Intronic
1006417456 6:33913120-33913142 TGCTAAGCAATCTGTGAAATGGG + Intergenic
1006573693 6:35027147-35027169 TGGCCAGAAATCTCAGAAATGGG + Intronic
1006935934 6:37717697-37717719 AGTCAAGCAATCTGAAAAATGGG + Intergenic
1007723873 6:43902545-43902567 AGGCCAGAACTGTGGGAAATAGG + Intergenic
1010985729 6:82421640-82421662 AGGAATGCAATCTGTAAAATGGG + Intergenic
1011651070 6:89506686-89506708 TGGCAAGCAAACTGTGGAATGGG - Intronic
1014398760 6:120960769-120960791 AAGCCAGCCACCTGTGAAAAGGG - Intergenic
1014400564 6:120984519-120984541 TGGCCAACAATCTTTTAAATGGG - Intergenic
1015283508 6:131459037-131459059 AGGTCAGCAATTTCTGAAAAGGG + Intergenic
1023320375 7:38990822-38990844 AGCCCAGCAATGCGGGAAATTGG + Intronic
1024000275 7:45185006-45185028 TGGCCAGCTATCTCTGAGATGGG + Intronic
1024392806 7:48834849-48834871 AGGCCAGATAGCTGTGTAATGGG - Intergenic
1026217950 7:68366085-68366107 AGGGCAGGAGGCTGTGAAATAGG + Intergenic
1028741937 7:94285362-94285384 AGGAGAGCAATCAGTGAGATGGG - Intergenic
1030836113 7:114288296-114288318 AGAGCAGCAAGCAGTGAAATGGG - Intronic
1032466604 7:132149926-132149948 GGGCATGCCATCTGTGAAATGGG - Intronic
1037649132 8:20820806-20820828 ACCCCAGCAATATGTGAAATAGG - Intergenic
1038459626 8:27705006-27705028 AGGGCAGCATCCTGTGAATTTGG + Intergenic
1039122949 8:34169260-34169282 GGGCCAGAAATCAGTGAAAATGG - Intergenic
1039441891 8:37600795-37600817 AGTCTCCCAATCTGTGAAATGGG - Intergenic
1039970254 8:42315993-42316015 AGGTCAGCAATCTCTGATTTGGG + Intronic
1040114064 8:43594539-43594561 AGAGAAGCAATCTGTGAAACTGG + Intergenic
1041745446 8:61203790-61203812 ATGCTAGCAATCTGTGTAAGGGG - Intronic
1044908081 8:97026621-97026643 AGGCCTTCACTCTGTGAAGTAGG + Intronic
1044962464 8:97544098-97544120 AGGGCAGGAATCTGGGAGATGGG - Intergenic
1047206534 8:122806846-122806868 AGGCTTCCCATCTGTGAAATGGG - Intronic
1049124872 8:140777725-140777747 AGGCCACCAATCCTTCAAATGGG + Intronic
1049353334 8:142175763-142175785 GAGCCTGCCATCTGTGAAATGGG + Intergenic
1049905388 9:211991-212013 AGTACAGAAATCTGGGAAATAGG + Intergenic
1050100492 9:2114028-2114050 AGGCCAACAGTCTCTAAAATGGG - Intronic
1052569526 9:30201505-30201527 AGGCCAGAAATCTGTAATCTAGG + Intergenic
1053019788 9:34686974-34686996 TGCCCAGCAATCTGAGCAATTGG - Intergenic
1055766890 9:79673050-79673072 ATGCCAGCAACCAGTGAAAAGGG + Intronic
1056473073 9:86924825-86924847 AGGACTTCAATCTGTGAATTTGG + Intergenic
1057596709 9:96420681-96420703 ATGCCAGGAATGTGTGAACTGGG + Intergenic
1058445842 9:105054157-105054179 AGGCCAGCAAACTAGGAAAGGGG - Intergenic
1061838751 9:133345718-133345740 AGGCCAGGCTTCTGTGAAACTGG - Intronic
1188530830 X:31139029-31139051 AGGCAATGAATCTGTGAAGTAGG - Intronic
1190589302 X:51982374-51982396 AGAGTGGCAATCTGTGAAATAGG - Intergenic
1192436473 X:71146305-71146327 AGGCCTGCAATCTGGGAAGGCGG + Intronic
1192594040 X:72387613-72387635 GGGCAAGCCATCTATGAAATGGG + Intronic
1195235909 X:102898134-102898156 AGGTTAGTCATCTGTGAAATGGG - Intergenic
1195308855 X:103610469-103610491 AGTCTTGCCATCTGTGAAATGGG + Intronic
1197130902 X:123004522-123004544 AGGTCAGAAACCTGTGAAAGGGG - Intergenic
1201413862 Y:13728269-13728291 AGGCAAACCATCTGTGAATTAGG - Intergenic
1201673766 Y:16556160-16556182 AGGTCACCATTCTGTGGAATCGG - Intergenic