ID: 1092080198

View in Genome Browser
Species Human (GRCh38)
Location 12:5709663-5709685
Sequence CTCTGTGTTCATTCGCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092080187_1092080198 22 Left 1092080187 12:5709618-5709640 CCTCGCCCCTTAGGCTTCCCCAG 0: 1
1: 0
2: 1
3: 14
4: 307
Right 1092080198 12:5709663-5709685 CTCTGTGTTCATTCGCAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1092080188_1092080198 17 Left 1092080188 12:5709623-5709645 CCCCTTAGGCTTCCCCAGCTCTT 0: 1
1: 0
2: 3
3: 25
4: 242
Right 1092080198 12:5709663-5709685 CTCTGTGTTCATTCGCAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1092080193_1092080198 4 Left 1092080193 12:5709636-5709658 CCCAGCTCTTTAGGTTACCATAC 0: 1
1: 0
2: 2
3: 16
4: 395
Right 1092080198 12:5709663-5709685 CTCTGTGTTCATTCGCAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1092080190_1092080198 15 Left 1092080190 12:5709625-5709647 CCTTAGGCTTCCCCAGCTCTTTA 0: 1
1: 0
2: 3
3: 22
4: 323
Right 1092080198 12:5709663-5709685 CTCTGTGTTCATTCGCAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1092080192_1092080198 5 Left 1092080192 12:5709635-5709657 CCCCAGCTCTTTAGGTTACCATA 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1092080198 12:5709663-5709685 CTCTGTGTTCATTCGCAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1092080194_1092080198 3 Left 1092080194 12:5709637-5709659 CCAGCTCTTTAGGTTACCATACC 0: 1
1: 0
2: 2
3: 10
4: 91
Right 1092080198 12:5709663-5709685 CTCTGTGTTCATTCGCAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1092080189_1092080198 16 Left 1092080189 12:5709624-5709646 CCCTTAGGCTTCCCCAGCTCTTT 0: 1
1: 0
2: 1
3: 20
4: 225
Right 1092080198 12:5709663-5709685 CTCTGTGTTCATTCGCAGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092080198 Original CRISPR CTCTGTGTTCATTCGCAGTC TGG Intronic
909226728 1:73034057-73034079 CTGTGTGTTCAGTGGAAGTCTGG - Intergenic
916901934 1:169235012-169235034 CTCTGTATTGATTTTCAGTCTGG + Intronic
918970727 1:191414693-191414715 TTTTGTGCTCATTTGCAGTCAGG + Intergenic
924184043 1:241468034-241468056 CACTGTGTTCATTTGCACTCTGG - Intergenic
1063572152 10:7225661-7225683 CTCTGTTCCCATTCGCAGCCAGG - Intronic
1065481858 10:26202946-26202968 TTATGTGTTCATTTACAGTCAGG + Exonic
1070715916 10:78720802-78720824 CTATGTATTCATTCTCAGTGGGG + Intergenic
1073603330 10:104867995-104868017 CTCTGTATTCATTAGCATGCAGG + Intronic
1075260899 10:120963233-120963255 CTCTGAATTCTTTGGCAGTCAGG - Intergenic
1075515546 10:123105143-123105165 CTATGTGTGCACTTGCAGTCAGG - Intergenic
1077825690 11:5806219-5806241 CGCCGTGTTCATTGGCAGTCAGG + Intronic
1078405726 11:11068350-11068372 CAGTGTGTTCATTTGCAGCCAGG - Intergenic
1086552861 11:88072273-88072295 CACTGTGTTCATCAGCAGACTGG + Intergenic
1089525976 11:119096831-119096853 CTCTGTGATCATTGGCATCCTGG - Exonic
1090162503 11:124510380-124510402 CTCTGTCTGCAATGGCAGTCAGG + Intergenic
1092080198 12:5709663-5709685 CTCTGTGTTCATTCGCAGTCTGG + Intronic
1101359974 12:104017247-104017269 TTCTGTTTTCATTTGCAGTAAGG + Intronic
1104324942 12:127786774-127786796 GTCTGTGTTCTGTCCCAGTCAGG + Intergenic
1107162059 13:37241815-37241837 CTCTGTGTTCATTTCAAGTTGGG - Intergenic
1112916623 13:104558899-104558921 CTCTGTGTTGGTTCCCAGTTGGG + Intergenic
1117035709 14:51726484-51726506 CTCTTTTTTCATTTGCATTCTGG + Intronic
1118383466 14:65236666-65236688 CTCTTGGGTCATTCACAGTCTGG - Intergenic
1122590036 14:102842456-102842478 CTCTGTGATCTCGCGCAGTCTGG - Intronic
1123992101 15:25691231-25691253 CACTGTGTTCACTCTCGGTCTGG - Intronic
1124425129 15:29557053-29557075 ATCTGTGTTCTTTCTAAGTCAGG - Intronic
1124694930 15:31856839-31856861 CTCTGAGCTCTTTCGCAGCCGGG + Intronic
1125482812 15:40092292-40092314 CTCTGTGTTACTTTGGAGTCGGG - Intronic
1133544033 16:6787717-6787739 CTCTGTGCTCATTTGCAGCTTGG - Intronic
1134680053 16:16118468-16118490 ATCTGTGTTCATACGCAAGCTGG + Intronic
1134825883 16:17283962-17283984 CTCTGTGTTTATTCTCTGACTGG - Intronic
1139957970 16:70702135-70702157 CTCTCTGTTCATGCCCAGGCAGG + Intronic
1146525470 17:33563701-33563723 CTCTGAGATCATTTCCAGTCTGG - Intronic
1150475740 17:65473185-65473207 CTCTATGCTTATTCTCAGTCTGG - Intergenic
1151763155 17:76118696-76118718 ATCTGAGTTTTTTCGCAGTCTGG + Intronic
1152734738 17:81991855-81991877 CTCTGTGTTCATGTCCTGTCTGG - Intronic
1153501066 18:5750685-5750707 CTCTGTGTACCTTTCCAGTCTGG - Intergenic
1153946456 18:10022481-10022503 CTTTGTGTTCAGTCGCAGACCGG + Intergenic
1155952477 18:31928301-31928323 CGCTGTGTTTATTAGCAGGCTGG - Intronic
1160433785 18:78830862-78830884 CTCTGGGTTCTTTCTCAGCCTGG - Intergenic
1161325905 19:3664065-3664087 CTCAGGGTTCATTCGCACTGGGG - Intronic
1163274893 19:16277347-16277369 CTCTGTGTTCAGTCCCTGCCTGG + Intergenic
1166370212 19:42296102-42296124 CTCTGGGGTCATTCGTACTCAGG + Intergenic
925832089 2:7905812-7905834 CTCTATGATCCTTTGCAGTCTGG - Intergenic
937902685 2:127033980-127034002 CACTGTGTTCATTCATATTCTGG - Intergenic
947968357 2:234301371-234301393 CTCTGTTTTCCTTTGAAGTCAGG + Intergenic
1171024383 20:21615471-21615493 TTGTGTGTCCATTTGCAGTCTGG - Intergenic
1171339588 20:24416860-24416882 CTGTGAGATCATTCACAGTCCGG + Intergenic
1184388243 22:44188279-44188301 CTCCGTGTTCCTCCTCAGTCTGG + Intronic
1184570091 22:45317600-45317622 CTCTGTTTTCCTTGGCACTCTGG + Intronic
1185168751 22:49278639-49278661 CTCTATTTGCATTCGCAGCCCGG - Intergenic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950555379 3:13692599-13692621 CTCTGTTTTCATTCGCCAGCTGG + Intergenic
952191054 3:31023956-31023978 CTCTGCTTGCATTAGCAGTCAGG + Intergenic
959999868 3:112719907-112719929 CTCTGTTTTCTCTAGCAGTCTGG + Intergenic
964387056 3:156158990-156159012 CTGAGTCTTCATTCTCAGTCAGG - Intronic
967296138 3:187967008-187967030 CTCTGTGTTCTATCGACGTCTGG + Intergenic
968757443 4:2424085-2424107 CTCTGTGTCCATGCACAGCCAGG + Intronic
969041875 4:4304864-4304886 CTCTGTTTTCATTTCCAGTATGG + Intronic
971707860 4:30070615-30070637 CTCAGTTTTCAGTGGCAGTCTGG + Intergenic
975089140 4:70379953-70379975 CTTTGTTTACATTCACAGTCTGG + Intronic
976017507 4:80575532-80575554 CTCTTTTTTTTTTCGCAGTCTGG + Intronic
976571461 4:86616613-86616635 CTCTGGGTTCATACGAGGTCAGG + Intronic
979459390 4:120963704-120963726 CTCTTTTTTCCTTCACAGTCTGG + Intergenic
982460824 4:155667328-155667350 CTCTTTCTCCATTCGCAGTGCGG + Exonic
982667406 4:158282577-158282599 CTCTGTGTTCTATCAAAGTCAGG + Intergenic
985697315 5:1347919-1347941 CTCTGTATTCATTCACACTTTGG + Intergenic
986060970 5:4189500-4189522 TTCTGTGTTCACTCCCACTCAGG + Intergenic
998117831 5:139551835-139551857 CTTTATGTTTATTAGCAGTCTGG - Intronic
1002316620 5:178348243-178348265 CTCTGTGTTCCCACGCACTCGGG + Intronic
1008455998 6:51711365-51711387 CTCTGTTTTCAGTGGCATTCAGG + Intronic
1018808904 6:167283332-167283354 CTCTGTTTTCATGTGAAGTCTGG + Intronic
1028028884 7:85882876-85882898 TTTTGTTTTCATTCACAGTCAGG - Intergenic
1028095438 7:86754864-86754886 CTCTGTGTTTATTCTCAGACAGG + Intronic
1033267030 7:139895487-139895509 CTCTGTGTTCCTACTCAGCCCGG + Intronic
1034522387 7:151631067-151631089 ACCTCTGTTCATTCACAGTCAGG - Intronic
1034899374 7:154898116-154898138 CTCTGTGTTGATTCCCAGAGTGG + Intergenic
1035459728 7:159031381-159031403 CCCTGCGTTCATTCCCAGCCAGG - Intronic
1036046643 8:5149675-5149697 CTCTCTGTTCTTTGTCAGTCAGG - Intergenic
1037699686 8:21263243-21263265 CACAGTGTTCATTTGCAGGCAGG + Intergenic
1039806576 8:41005061-41005083 CTCTGGTTTCACTCTCAGTCTGG - Intergenic
1043656572 8:82674663-82674685 CTCTGTCTTCAATGGCAGTGGGG - Intergenic
1051002992 9:12307786-12307808 TTCTATGTTCATTTGCAGTCAGG - Intergenic
1056334306 9:85551013-85551035 CTCTGTGTTCATGCGAGATCTGG + Intronic
1188983078 X:36745114-36745136 CTATGTTTTCTTTCTCAGTCAGG + Intergenic
1190561473 X:51690363-51690385 CTCTGTCTTCTTTCTCTGTCTGG + Intergenic
1190562818 X:51702952-51702974 CTCTGTCTTCTTTCTCTGTCTGG - Intergenic