ID: 1092084353

View in Genome Browser
Species Human (GRCh38)
Location 12:5743316-5743338
Sequence GCACATTCGGTGATGAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092084346_1092084353 15 Left 1092084346 12:5743278-5743300 CCTGCTGGTCTGTGATCCAATGT 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1092084353 12:5743316-5743338 GCACATTCGGTGATGAGTAAAGG 0: 1
1: 0
2: 0
3: 4
4: 66
1092084349_1092084353 -1 Left 1092084349 12:5743294-5743316 CCAATGTGCAAACCAAGGGCCTG 0: 1
1: 0
2: 0
3: 24
4: 165
Right 1092084353 12:5743316-5743338 GCACATTCGGTGATGAGTAAAGG 0: 1
1: 0
2: 0
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092084353 Original CRISPR GCACATTCGGTGATGAGTAA AGG Intronic
909233306 1:73119275-73119297 CAACATCCGGTGATGAGAAATGG + Intergenic
909299589 1:73995220-73995242 GGGGATTCTGTGATGAGTAATGG - Intergenic
909925926 1:81438061-81438083 GCATATTCGGTGAGAAGGAATGG - Intronic
912809655 1:112784432-112784454 GCACCTTTGGAGATGGGTAATGG - Intergenic
912972576 1:114297825-114297847 GCAGAGTCGGTGCTGAATAACGG + Intergenic
919139155 1:193548719-193548741 TCTCATTAGGTGAAGAGTAATGG - Intergenic
1062978558 10:1702814-1702836 CCACATGCGATGATGAGTATGGG + Intronic
1068503091 10:57864867-57864889 GCACATTGGGGAATGAATAAGGG - Intergenic
1076244997 10:128939834-128939856 TCTCATTCTGTGATGAGAAAAGG - Intergenic
1084472556 11:69371688-69371710 GCACATAGGGAGATGAGTGAAGG + Intergenic
1087069528 11:94063793-94063815 GCACATTCTGTGTGGAGCAAAGG - Intronic
1092084353 12:5743316-5743338 GCACATTCGGTGATGAGTAAAGG + Intronic
1096539262 12:52295786-52295808 GCATATTAAGTGCTGAGTAATGG + Intronic
1101857196 12:108453475-108453497 TAACATTCTGTGATGGGTAATGG + Intergenic
1107736883 13:43408121-43408143 GAACATTTGGTGATGATGAAAGG + Intronic
1109811434 13:67518239-67518261 AAACATCAGGTGATGAGTAAAGG + Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1121403762 14:93705409-93705431 GCACATTCAGTGATGTGTCCTGG + Intronic
1128829850 15:70758118-70758140 GAACTTTAGGTGATGAGTAAAGG - Intronic
1134056395 16:11172910-11172932 CCACATTGGGTTATGAGTCATGG + Intronic
1135089541 16:19502128-19502150 GCAGATTCAGTGAGGGGTAAGGG + Exonic
1135272514 16:21081629-21081651 GCAAATTCGTTGAAAAGTAAGGG - Exonic
1137794712 16:51205807-51205829 GCACATTTGGTGAAGAGTACAGG - Intergenic
1138121891 16:54406817-54406839 GAACTTTCAGTGATGACTAAGGG + Intergenic
1140745294 16:77975526-77975548 GCAGATTCGGGGCTGAGTGAGGG - Intronic
1148189514 17:45668706-45668728 GCACAGTCTATGATGAGCAAAGG - Intergenic
1150631700 17:66884790-66884812 ACACATTCTGGGATGAGGAAGGG - Intronic
1153512492 18:5870635-5870657 CCACATTCAGTGATGAGGGATGG - Intergenic
1158556822 18:58482246-58482268 GCACATACAGTGATGATCAAAGG + Intronic
1159193041 18:65073145-65073167 ACACATACAGTGATGAGTTATGG - Intergenic
942029197 2:171941750-171941772 GCACAGCAGGAGATGAGTAATGG - Intronic
945548314 2:211186480-211186502 ACACATTTAGTGATGAGGAAGGG - Intergenic
946321617 2:218958056-218958078 GCATATTGGGTGCTGAGTTAGGG + Intergenic
1168935355 20:1660755-1660777 GCACCTGCTGTGATGAGTCAGGG - Intergenic
1170747383 20:19112634-19112656 GCACATGAGGTGATGGGGAAAGG + Intergenic
1182606016 22:31504486-31504508 ACACATCCTGTGTTGAGTAACGG - Intronic
1185247229 22:49779663-49779685 GCCCACTCTGTGATGAGTATGGG - Intronic
950663348 3:14480626-14480648 GCAGAGTCGGTGATGGGCAAGGG - Intronic
956388353 3:68745100-68745122 GCAAATTCCGTTATGAGTTAAGG + Intronic
966334798 3:178856139-178856161 GCCCATTGGGTGATGGGGAATGG - Intergenic
967256163 3:187594181-187594203 GCACATGCTGTGATAAATAAAGG - Intergenic
975882712 4:78929431-78929453 GAACATGAGGTGATGAGTTAAGG + Intronic
978635273 4:110797260-110797282 GCAAATTCTCTGATGAGAAAGGG + Intergenic
986147585 5:5093462-5093484 GCAAATTTGGAGATGAGGAAAGG + Intergenic
991636364 5:68709964-68709986 GTCCATTCTGTGATGAGCAAAGG - Intergenic
993631775 5:90294422-90294444 GCACACTTGGTGATGAGGGAAGG + Intergenic
993746344 5:91602050-91602072 GAAGATTCGGTGAGGGGTAAAGG - Intergenic
994584571 5:101690298-101690320 ACACAATAGGTGATGTGTAAAGG - Intergenic
1003171784 6:3726165-3726187 GCACAACTGGTGATGAGGAAGGG + Intronic
1006658424 6:35617667-35617689 ACACATTTGGTGTTCAGTAAAGG - Intronic
1008625726 6:53314544-53314566 ACACATTTGGTGCTCAGTAAAGG - Intronic
1012186690 6:96226037-96226059 GCACATGAGATGATGAGGAAAGG + Intergenic
1015581413 6:134729467-134729489 GCACAGTGAGTGTTGAGTAAGGG - Intergenic
1015588198 6:134797459-134797481 TCATATTTGGTGATGAGTATAGG + Intergenic
1016211964 6:141548142-141548164 GCTCAATGGGTGATTAGTAATGG - Intergenic
1023543319 7:41289526-41289548 TCACCTTCTGTCATGAGTAAAGG + Intergenic
1030847816 7:114443087-114443109 GCACATTGTGTGATCATTAAAGG + Intronic
1034332616 7:150295944-150295966 GCTCATTCAGAGACGAGTAAGGG + Intronic
1034665420 7:152813931-152813953 GCTCATTCAGAGACGAGTAAGGG - Intronic
1034921963 7:155090789-155090811 TCACATTAGGTGATGTGTAAAGG - Intergenic
1043846823 8:85173232-85173254 GCCCATTCGGTGATCATGAATGG - Intergenic
1044062529 8:87655998-87656020 GCACATTTTGTGATAAGTAATGG - Intergenic
1044589342 8:93898610-93898632 GGACATTCTGTAATGAATAAGGG - Intronic
1046302829 8:112320319-112320341 GGGCATTCAGTGATGAGTATTGG - Intronic
1047345906 8:124028416-124028438 GCTCATTCAGTGAAGAGAAAGGG - Intronic
1055791637 9:79928891-79928913 CCACATTTGGTGAAGGGTAATGG - Intergenic
1056735168 9:89203256-89203278 GCAGATTCGGTGATGGGGGAGGG + Intergenic
1057934869 9:99228540-99228562 GCTCATTAGGTGATGGGAAATGG + Intronic
1058415556 9:104785011-104785033 GCACATACGGTCTTGATTAAAGG + Intronic
1059046710 9:110876969-110876991 GCCCATTAGGTGAGGTGTAATGG - Intronic
1187151469 X:16685455-16685477 TCACATTCGGTGATGGCTGATGG - Intronic