ID: 1092084449

View in Genome Browser
Species Human (GRCh38)
Location 12:5744174-5744196
Sequence ATAGAGAAGAAGACGGTGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 297}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1092084445_1092084449 -7 Left 1092084445 12:5744158-5744180 CCACAGAGCCATGAAGATAGAGA 0: 1
1: 0
2: 1
3: 28
4: 283
Right 1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 297
1092084444_1092084449 -6 Left 1092084444 12:5744157-5744179 CCCACAGAGCCATGAAGATAGAG 0: 1
1: 0
2: 1
3: 28
4: 225
Right 1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 297
1092084442_1092084449 2 Left 1092084442 12:5744149-5744171 CCACATACCCCACAGAGCCATGA 0: 1
1: 0
2: 0
3: 18
4: 255
Right 1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 297
1092084441_1092084449 13 Left 1092084441 12:5744138-5744160 CCTGGTGATGGCCACATACCCCA 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 297
1092084438_1092084449 27 Left 1092084438 12:5744124-5744146 CCCATATAAGCAAGCCTGGTGAT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 297
1092084437_1092084449 30 Left 1092084437 12:5744121-5744143 CCACCCATATAAGCAAGCCTGGT 0: 1
1: 0
2: 1
3: 3
4: 65
Right 1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 297
1092084439_1092084449 26 Left 1092084439 12:5744125-5744147 CCATATAAGCAAGCCTGGTGATG 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 297
1092084443_1092084449 -5 Left 1092084443 12:5744156-5744178 CCCCACAGAGCCATGAAGATAGA 0: 1
1: 0
2: 1
3: 22
4: 211
Right 1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1092084449 Original CRISPR ATAGAGAAGAAGACGGTGGC AGG Exonic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
901948278 1:12721104-12721126 AGAGAGAAAAAGAAGGCGGCTGG + Intronic
902159293 1:14516811-14516833 ATAGAAAAGAAGAAGAAGGCTGG - Intergenic
902671315 1:17976041-17976063 AAAGAGAACAAAACGGTGGTGGG - Intergenic
902911805 1:19604095-19604117 ATAGATAAGAAAACTGAGGCTGG - Intronic
903870717 1:26432401-26432423 CTAGAGGAGAAGAGGGTGACTGG + Intronic
904357090 1:29947337-29947359 ATAGATAAGAAGACTGAGGCTGG - Intergenic
904541670 1:31238072-31238094 ACAGATAAGAAGACTGAGGCCGG + Intronic
905223972 1:36467414-36467436 AGAGAGAAGAAGCTGGGGGCTGG + Intronic
905430621 1:37920366-37920388 ATACAAAAGAAGAATGTGGCCGG + Intronic
905550184 1:38831232-38831254 ACAGAGAAGAGGAAGCTGGCAGG + Intergenic
907960194 1:59272223-59272245 ATAGTGAAGAAGACTGTGTTTGG + Intergenic
908353713 1:63311252-63311274 AGAAAGAAGAAGAAGATGGCTGG - Intergenic
909288786 1:73855696-73855718 TTAGAGAAAAGGAAGGTGGCAGG + Intergenic
909454748 1:75837682-75837704 TTAGAAAAGAAGATGGCGGCCGG - Intronic
909596538 1:77412713-77412735 AGAGAGAAAAAAACAGTGGCGGG - Intronic
910980111 1:92951926-92951948 ACAGAGAAGGAGAGGGTGGGGGG - Intronic
911011496 1:93285975-93285997 ATAGAGCAGAAGGCGGTATCTGG + Intergenic
911122795 1:94312736-94312758 TTAAAGAAGAAGACGGGGCCAGG - Intergenic
911712648 1:101092869-101092891 AGAGAGAAGAAGTCAATGGCTGG - Intergenic
916683609 1:167125973-167125995 AGAGAGAAGAGGACTATGGCCGG + Exonic
919463542 1:197906409-197906431 AGAGAGAGGAAGGTGGTGGCGGG - Intronic
920326181 1:205166200-205166222 ATGGAGAAGAACTGGGTGGCTGG + Intronic
920645477 1:207800495-207800517 ATCTAGAGGAAGACTGTGGCAGG + Intergenic
921366319 1:214378077-214378099 CTAGAGAAGCAGAAGATGGCAGG - Exonic
924068970 1:240255693-240255715 ATAAAGGAGAAGAAGCTGGCTGG + Intronic
924328050 1:242915127-242915149 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1062974285 10:1672166-1672188 AGAGAGAGGAAAACGATGGCAGG - Intronic
1065884051 10:30061244-30061266 ATAGTCAAGAAAATGGTGGCCGG + Intronic
1067775966 10:49165163-49165185 AAAGAGAAGAGAATGGTGGCTGG + Intronic
1068835362 10:61546668-61546690 ATCGTTAAGAAGAAGGTGGCGGG - Intergenic
1070089449 10:73270452-73270474 AGAGAAAAGAAAAGGGTGGCTGG - Intronic
1070287958 10:75097579-75097601 ATAGGGAAAGAGACGGTGGGAGG + Intronic
1073081606 10:100864336-100864358 AGAGAGAAAAAGACAGTGTCAGG + Intergenic
1074204420 10:111270199-111270221 ATCTAGAAGCAGGCGGTGGCAGG - Intergenic
1074997832 10:118773117-118773139 ATAGATAAGAAGAGAGAGGCTGG - Intergenic
1075354717 10:121761071-121761093 AGAGAGGAGAGGAAGGTGGCAGG - Intronic
1077202357 11:1317088-1317110 AAAGAGACAAAGAAGGTGGCTGG - Intergenic
1077280419 11:1742437-1742459 ATAGAGAAAGTGACAGTGGCTGG + Intronic
1077866218 11:6223748-6223770 AAAGAGAAGAAGACGGGGAGCGG + Exonic
1079155271 11:17940299-17940321 ATAGAGGAAAAGACGGTGCATGG + Intronic
1079301531 11:19283337-19283359 ATAGATAATAATATGGTGGCTGG + Intergenic
1080562182 11:33474046-33474068 AGAGAGAGGGAGAAGGTGGCAGG + Intergenic
1081489510 11:43556649-43556671 AGAGAGAAAAAGAGGGTGGGGGG - Intronic
1083010865 11:59397736-59397758 GTAGAGAAGGAGACTGTGACAGG + Intergenic
1083478882 11:62930769-62930791 AAAGAGAAGAACACAGAGGCAGG - Intergenic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084554400 11:69867360-69867382 AGAGGGAAGAAAACGGTGGTGGG - Intergenic
1084598633 11:70132040-70132062 ACAGAGAAGAAGACCGTGGCGGG - Exonic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1088894180 11:114065293-114065315 ATAGAGAAGGAAACGGAAGCCGG - Intronic
1089187677 11:116631292-116631314 AGAGGGAAGCAGAGGGTGGCTGG - Intergenic
1089881404 11:121777057-121777079 ACAGAGAAAAAGAGGGAGGCAGG + Intergenic
1090818629 11:130320188-130320210 AGAGAGAAGAAGGCAGTGGCTGG - Intergenic
1090974988 11:131672823-131672845 ACAGAGAAGACCACGGTGCCGGG + Intronic
1090975006 11:131672890-131672912 ACAGAGAAGACCACGGTGCCGGG + Intronic
1090975024 11:131672957-131672979 ACAGAGAAGACCACGGTGCCGGG + Intronic
1090975041 11:131673024-131673046 ACAGAGAAGACCACGGTGCCGGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG + Exonic
1092711603 12:11343667-11343689 ATAAAAAAGAAGAAAGTGGCTGG - Intergenic
1096476885 12:51913914-51913936 ATAGAGAAGGGGGCTGTGGCTGG + Intronic
1096489357 12:52005328-52005350 CTAGAGAAGAAGACTGAGCCAGG + Intergenic
1097142293 12:56912168-56912190 ACAGAGAGGAAGATGGGGGCTGG + Intergenic
1097176951 12:57148838-57148860 ATGGGGAAGAAGGAGGTGGCTGG + Intronic
1101289340 12:103351935-103351957 AAAGAGAGGAAGAGGGTGGAGGG - Intronic
1103507218 12:121449613-121449635 AAAGAGAAAAAGACAGTCGCGGG + Intronic
1104863302 12:131936810-131936832 ATACAGAAGACGAAGGTGGCAGG + Intronic
1105408380 13:20150335-20150357 ACAGAGATGAAGAGGGAGGCAGG + Intronic
1107516447 13:41134043-41134065 TGAGAGAGGAAGACAGTGGCAGG - Intergenic
1109142023 13:58725296-58725318 ATGGAGAAGGAGCTGGTGGCAGG + Intergenic
1110403380 13:75120519-75120541 AAAGAGAAGAAAAAGATGGCAGG + Intergenic
1111086179 13:83378383-83378405 ATAAAGAAGACGAGGCTGGCAGG + Intergenic
1113074353 13:106453222-106453244 CCAGAGAAGAAGACAGAGGCAGG + Intergenic
1114864998 14:26579349-26579371 ATATATAAGAATACGATGGCTGG - Intronic
1115111457 14:29828325-29828347 AGAGAGAAGGAGAAGGTGCCAGG + Intronic
1117087533 14:52217046-52217068 AAAGAGAAGAAGAAAGTTGCAGG - Intergenic
1117747626 14:58886785-58886807 ATAGAGAAGAAGGCCATAGCAGG - Intergenic
1117805999 14:59491283-59491305 ATAGAGAAGACGATGCTGGTGGG + Intronic
1118116938 14:62789104-62789126 ATAGAGAATAAAACAGTGGTGGG - Intronic
1120040604 14:79748657-79748679 ATAAAGAAGAGGCCAGTGGCGGG + Intronic
1121565600 14:94907161-94907183 CAAGAGAAGAAAACGGGGGCGGG - Intergenic
1121998054 14:98621078-98621100 AGAGAGGAGAAGACGATGCCTGG + Intergenic
1123964096 15:25438561-25438583 AAAGAGAACGAGGCGGTGGCGGG - Exonic
1124358599 15:29017664-29017686 AAAGAAAAGAAGATGGTGCCGGG - Intronic
1126040753 15:44588407-44588429 ATAGAGAAGAAGATAGTGACAGG + Intronic
1126415220 15:48411132-48411154 ACAAAGAAGAAGCCAGTGGCTGG - Exonic
1128220877 15:65967720-65967742 AAGGAGAAGAGGACGGTGACTGG + Intronic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1129698535 15:77754396-77754418 ATTCAGAAGCGGACGGTGGCTGG - Intronic
1130040239 15:80400375-80400397 ATAGAGAAGAAGGCAGGGGTGGG + Intronic
1131835435 15:96386030-96386052 ATAGAAAAGATGACCTTGGCTGG + Intergenic
1132147211 15:99436142-99436164 ATAGAGCAGAAGGGGCTGGCAGG - Intergenic
1132533661 16:466742-466764 AGAGAGAAGGGGACGGTGTCTGG - Intronic
1133436255 16:5782549-5782571 AGATAGAAGAAGACAGTGTCAGG + Intergenic
1133757437 16:8772807-8772829 AAAAAGAAGAAGACGGTGGCCGG + Exonic
1133942487 16:10321993-10322015 AGAGAGAAGAGGACGTTGGAGGG - Intergenic
1134504506 16:14794063-14794085 AAAGAGAAGAAGATGTTTGCAGG - Intronic
1134576065 16:15334846-15334868 AAAGAGAAGAAGATGTTTGCAGG + Intergenic
1134726377 16:16421655-16421677 AAAGAGAAGAAGATGTTTGCAGG - Intergenic
1134941054 16:18290204-18290226 AAAGAGAAGAAGATGTTTGCAGG + Intergenic
1135759615 16:25126493-25126515 GTAGAGAGGAAGACGGTCACGGG - Intronic
1136407182 16:30054850-30054872 ACAGCGATGAAGACGATGGCAGG - Exonic
1136461863 16:30416391-30416413 ACAGAGATGAGGACGGTGGGAGG - Intronic
1137738685 16:50743091-50743113 ATTGAGGAGAAGAAGGTGGCAGG - Intronic
1138854687 16:60675439-60675461 TAAGGGAAGAAGACGGTGGCAGG - Intergenic
1139156004 16:64443262-64443284 GGAGAGAAGAAGAAGGTGCCAGG + Intergenic
1140288701 16:73629569-73629591 AATGAGAAGAAGATGGAGGCTGG + Intergenic
1140781423 16:78300426-78300448 TTAGAGAATAAAAAGGTGGCAGG - Intronic
1140864253 16:79046096-79046118 ATAGAAAAGAAAACTGTGGCCGG - Intronic
1141326768 16:83067812-83067834 AGAGAGAAGAAGAGAGGGGCAGG - Intronic
1141568156 16:84917325-84917347 ATAGAGCTGAAGACAGTGCCTGG - Intronic
1141991244 16:87611632-87611654 ATAGAGCAGCAGACAGAGGCGGG - Intronic
1144044135 17:11439716-11439738 AAAGGGAAGAAGAGGGTGGAAGG - Intronic
1144291044 17:13826567-13826589 GTAGAGATGAAAAGGGTGGCTGG + Intergenic
1144751091 17:17648515-17648537 ATTGACAATAAGAAGGTGGCTGG + Intergenic
1144770969 17:17759226-17759248 CTAGAGAAGAAGAAGCGGGCAGG + Intronic
1145221383 17:21092458-21092480 AAAAAGAAGAAGAAGGTGGTGGG - Intergenic
1146296285 17:31653187-31653209 AGAGAGGAGAAGAAGGTGCCAGG + Intergenic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1147749229 17:42718386-42718408 AAAGAGAAGGAAATGGTGGCTGG + Intronic
1147848551 17:43423076-43423098 AGAGAGAAGAAGACAGTGTGTGG + Intergenic
1148602077 17:48901778-48901800 AGAGAGAGGGAGACGGGGGCGGG - Intergenic
1149412866 17:56427063-56427085 AGAGGGAAGAAGACTGGGGCTGG + Intronic
1149733647 17:58971859-58971881 ATAGATAAGAAAACTATGGCAGG - Intronic
1153359422 18:4176734-4176756 ATAGAGAAGCAGAGGGTTCCAGG - Intronic
1153723520 18:7932138-7932160 AAAGAGCAGAAGACGGAGGTGGG + Intronic
1155108547 18:22690838-22690860 TTAGCAAAGATGACGGTGGCAGG - Intergenic
1155203831 18:23540070-23540092 ATGGAGAATAAGAGGGTGCCAGG + Intronic
1155608222 18:27632621-27632643 ATAGAGGAGAATAAGGAGGCTGG + Intergenic
1157522602 18:48355743-48355765 ATTGAGAAGAGGAAGGTTGCAGG - Intronic
1157721930 18:49931916-49931938 AGAGGAAAGAAGCCGGTGGCTGG - Intronic
1158127885 18:54122112-54122134 ATAGAGAAGAAGAGGTTTGATGG + Intergenic
1158446387 18:57526025-57526047 AGAGGGAAGAAGACGGTGGAAGG + Intergenic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1161647825 19:5465234-5465256 AGAGAGAAGGAGTCAGTGGCCGG + Intergenic
1161810666 19:6469325-6469347 AAAAAAAAGAAGACTGTGGCTGG - Intronic
1162053952 19:8051794-8051816 ATGGAAAAAAAAACGGTGGCCGG - Intronic
1162085119 19:8244060-8244082 AAAATGAAGAAGACGGAGGCAGG + Intronic
1164465865 19:28487093-28487115 CTAGAGAAGAGGCCTGTGGCTGG + Intergenic
1165857030 19:38885399-38885421 AAAGAAAAGAAAACAGTGGCTGG - Intronic
1166882133 19:45936072-45936094 ACAGGGCAGAAGAAGGTGGCTGG + Exonic
925380382 2:3420827-3420849 ATACAGAAGAAGTGTGTGGCAGG + Intronic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
927279894 2:21295538-21295560 ATAGAGCAGAAGAGCTTGGCAGG - Intergenic
928363236 2:30682191-30682213 AGAGAGAAGAAAACATTGGCCGG - Intergenic
928508290 2:31977104-31977126 ATAGAGAAGCAGAAGACGGCAGG + Intronic
928902798 2:36338673-36338695 AGAGAGAAGGGGAGGGTGGCAGG - Intergenic
929783977 2:44975955-44975977 AAAGAGCAGAAGCCGGGGGCGGG + Intergenic
934607385 2:95707094-95707116 AAAGGGAAGAAGACAGTGGCTGG - Intergenic
935371558 2:102352129-102352151 AAAGGGAAGAAAATGGTGGCTGG - Intronic
937703899 2:124895796-124895818 ATAGAGAATAAGACAGTGGGAGG + Intronic
938269704 2:129958680-129958702 ATAAAGATGAAGACACTGGCCGG - Intergenic
938619024 2:133030362-133030384 ATAGAGACAAACACGGCGGCTGG - Intronic
938810335 2:134846889-134846911 ATAGAGAGCAAGAGGCTGGCTGG + Intronic
939155178 2:138516590-138516612 ATAGTGAAGAAAACTGTGGAGGG + Intronic
940985064 2:160044447-160044469 AGAGAGAAAAGGACGGTGGAAGG - Intronic
941060470 2:160841821-160841843 AGAGAGAGGAAGATGGTGGATGG + Intergenic
941438474 2:165502726-165502748 AGAGAGAGGGAGCCGGTGGCAGG - Intronic
941616324 2:167724712-167724734 AGCGAGAAGATGACAGTGGCTGG + Intergenic
941947798 2:171119357-171119379 AGAGAGAACAAGAAGGTGGTGGG - Intronic
942305005 2:174598776-174598798 ATAGAGATAAAGAGGGTGGAAGG + Intronic
943277065 2:185881067-185881089 ATAGGTAAGAAGGCTGTGGCAGG + Intergenic
943766270 2:191665682-191665704 ATAGAGAAGGAGATGATGGTGGG + Intergenic
944385510 2:199159618-199159640 ATAGAGTATAAGACTGTGGATGG - Intergenic
945167629 2:206962702-206962724 AGAGAGAACAAAAGGGTGGCTGG - Intronic
945318399 2:208394412-208394434 ATAGAGAAGAAAACAGTAGGGGG + Intronic
945402575 2:209404394-209404416 AGAAAGAAGAAAACTGTGGCCGG + Intergenic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946467943 2:219929236-219929258 ATAGAGAAGAGGAAGTTGACTGG + Intergenic
949003818 2:241633873-241633895 ACCGAGAAGAAGAGGGGGGCTGG - Exonic
949011373 2:241680979-241681001 AGAGAGCAGAGGATGGTGGCGGG + Intronic
1169052001 20:2587206-2587228 AATGAGAAGAAGACAATGGCAGG - Intronic
1169616318 20:7450076-7450098 GTAGAGGAGAAGACGTTGCCTGG + Intergenic
1169937801 20:10903615-10903637 ATAGTAAAGAATACTGTGGCGGG + Intergenic
1170378885 20:15734246-15734268 AGAGAGAAGAACAGGGTGGAAGG + Intronic
1171489453 20:25506417-25506439 GTAGAGAAGAAGCCTGTGGCAGG - Intronic
1172365242 20:34344052-34344074 AAAAAGAAGAAGAAGGTGGCAGG - Intergenic
1172540012 20:35705312-35705334 ACAGAGAAGAAGAAGTTGGATGG - Exonic
1172598019 20:36163844-36163866 ATAAAGAAGAAGGCACTGGCAGG - Intronic
1172796589 20:37544058-37544080 ATAGGTAAGAGGACTGTGGCTGG + Intergenic
1173163917 20:40672620-40672642 AAAAAGAAGAAGAAGGTGGGTGG + Intergenic
1173315545 20:41940041-41940063 ATAGAAAAAAAGACATTGGCAGG + Intergenic
1174001025 20:47374815-47374837 ATAAAGAAGAAGAAGAAGGCTGG + Intergenic
1174017688 20:47502030-47502052 ATAAAGGAGGAGGCGGTGGCGGG + Intronic
1174931990 20:54826364-54826386 ACACAGAAGAAGACGGGAGCAGG - Intergenic
1175449055 20:59046979-59047001 AAAGAGAAGAAGACAGTTGAAGG - Intergenic
1175609432 20:60338395-60338417 ATAGAGAAGCAGCTGCTGGCTGG - Intergenic
1175963065 20:62646787-62646809 TTTGAGAAGAAGACGGAGGCTGG - Intronic
1177965416 21:27720582-27720604 AGAGAGGAGAAGAAGGTGCCAGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180009772 21:45041593-45041615 AGACAGAAGAAGACGGGAGCCGG + Intergenic
1180861013 22:19082788-19082810 AAAGAAAAGAAAAAGGTGGCTGG + Intronic
1181646115 22:24232539-24232561 AGAGAGAGGAAGAAGGAGGCCGG + Intronic
1182672084 22:32004886-32004908 ATTGAGAAGCAGACACTGGCTGG - Intergenic
1183276701 22:36902736-36902758 ATATAGAGGAAGTCAGTGGCAGG + Intergenic
1183521852 22:38300229-38300251 ACAGAGAAGAAGCCTGAGGCAGG + Intronic
1183613777 22:38928978-38929000 ATAAAAAAGAAGGTGGTGGCTGG - Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184481982 22:44753111-44753133 ATAGATGAGAAAACGGAGGCCGG + Intronic
949575186 3:5331887-5331909 AAAGAGGAGAAGAAGGGGGCAGG - Intergenic
949898128 3:8785585-8785607 ATAGATAAGAAGTCAGAGGCTGG + Intronic
950224469 3:11222604-11222626 ACTGAGAAGAAGAAGATGGCAGG + Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
953339128 3:42119024-42119046 AGAGAGCAGCAGCCGGTGGCAGG - Intronic
955539567 3:59960113-59960135 AGAGAGAGGAAGACAGTGGGTGG + Intronic
955566641 3:60254442-60254464 AGAGACAAGAAGGTGGTGGCAGG + Intronic
955994207 3:64661672-64661694 ATTGAGAAAAAGACAGTGCCTGG + Intronic
956635468 3:71359807-71359829 AGATAGAAGAAGACTGTGTCTGG - Intronic
957133770 3:76257444-76257466 ATAGAGAATAAGAGAATGGCAGG + Intronic
957290907 3:78277120-78277142 ATAGAAAAGAAGGTGTTGGCAGG + Intergenic
960391555 3:117083484-117083506 AAAGAGAAGAAAGTGGTGGCAGG + Intronic
960696625 3:120402702-120402724 ATGGAGAAGAGGGCGGTGGCTGG - Intronic
961589338 3:127964335-127964357 TTAAAGAATAAGATGGTGGCTGG + Intronic
961726340 3:128933389-128933411 ATAGAGGAGAAGGAGGAGGCTGG + Intronic
962603526 3:137012790-137012812 GTAGAGCAGAAAACGGGGGCTGG + Intergenic
966270346 3:178097210-178097232 ATAGATAAGAAAACTTTGGCGGG - Intergenic
966920981 3:184611187-184611209 ATAGAGATGCTGATGGTGGCGGG - Intronic
971116243 4:23648813-23648835 ATAGAGAAGAAAACAGTGGTGGG - Intergenic
972764860 4:42143173-42143195 ATACACAAGAACACGGTGGCTGG + Intronic
973783115 4:54308918-54308940 ATAGAGAAGAAAACTGTGGTAGG + Intergenic
974274946 4:59707048-59707070 TGAGAGGAGAAGACAGTGGCAGG - Intergenic
977187694 4:93960897-93960919 ATAGAGGAGACCACAGTGGCAGG + Intergenic
977889252 4:102289033-102289055 AAAGAGAAGAAGTCAGTGCCTGG + Intronic
978839198 4:113189714-113189736 ATTGAGAAGAAAGAGGTGGCAGG - Intronic
979471704 4:121106755-121106777 ATAGAACAGAAGATGGGGGCTGG + Intergenic
980147319 4:129004346-129004368 AAAGAGAAGAAAATGGTCGCTGG + Intronic
984423531 4:179554656-179554678 AGAGAGAACAAGAGGGAGGCAGG + Intergenic
984423582 4:179555456-179555478 AGAGAGAACAAGAGGGAGGCAGG - Intergenic
986012110 5:3725692-3725714 AAAATGAAGAAGACGGAGGCAGG - Intergenic
987081839 5:14432133-14432155 ATAGAGAACAGCACTGTGGCTGG - Intronic
987447133 5:18034082-18034104 ACAGAGAATAAAACGGTGGTGGG - Intergenic
991475896 5:67019157-67019179 ATATACAAGAAGACTGGGGCGGG + Intronic
992592990 5:78315043-78315065 AGAGAGAAAAAGACAGTGCCTGG - Intergenic
993479442 5:88405837-88405859 AGATAAAAGAAGACTGTGGCAGG - Intergenic
993599759 5:89907169-89907191 AGAGAGAAGAAGTCAGTGCCTGG - Intergenic
993942561 5:94077722-94077744 ATAGAGAATAAAGCGGTGGAAGG + Intronic
994162071 5:96567938-96567960 ATGGAGGAGGAGAGGGTGGCAGG + Intronic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997024668 5:130044682-130044704 ATAAAGAAGATGAAGGAGGCGGG + Intronic
997602331 5:135149247-135149269 AGAGAGAAGAAGGGGGAGGCTGG + Intronic
999238936 5:150116314-150116336 TTACAGAAGAAGACACTGGCCGG + Intronic
999674045 5:153981367-153981389 AAAGAGAAGAAGACAGGGTCTGG - Intergenic
999803655 5:155061589-155061611 ATAGAAAAGAAGGTGGTGGCTGG - Intergenic
1000918135 5:167106747-167106769 ATAGAGGTGAAGAGGGTGGAGGG + Intergenic
1002147454 5:177196119-177196141 AGAGAGAAGAAGATGGTTCCAGG + Intronic
1002606354 5:180385188-180385210 AGGGGGAAGAAGACGGTGGAGGG + Intergenic
1002881724 6:1258328-1258350 ATGGAGAAAGAGACGGTTGCTGG - Intergenic
1003019462 6:2497116-2497138 AGAGAGAAGGAGACGGTCACAGG + Intergenic
1003833918 6:10046748-10046770 AGAGAGAAAGAGACGGTGGGAGG + Intronic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004822045 6:19377862-19377884 AGAGAGGAGGAGACAGTGGCAGG - Intergenic
1006835793 6:36998218-36998240 ATAGAGAAGGAGCCTGTCGCTGG + Intergenic
1007143362 6:39600621-39600643 ATAGAGAAGGAGAAAGTGACTGG - Intronic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007988578 6:46232074-46232096 ATACAGAAGAAGACAGTGACAGG + Intronic
1009515271 6:64608336-64608358 ATAGAGAAGAAGAGGAAGGGAGG + Intronic
1010494562 6:76517479-76517501 ATAGAGAATAATACTGAGGCAGG + Intergenic
1010595390 6:77756673-77756695 AGAGAGAAGGAGAAGGCGGCGGG - Intronic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1012205541 6:96456423-96456445 ATAGAAAAGAAGATGTTTGCTGG - Intergenic
1017384965 6:153872686-153872708 ATAGAGAAGAAGTCAATGCCTGG - Intergenic
1017650684 6:156578752-156578774 ATAGAAGAGAAGACTGTGGATGG - Intergenic
1017686701 6:156920759-156920781 AGACAGAAGAAGATGGTGTCAGG + Intronic
1018163231 6:161068448-161068470 AAGGAGAAGAAGGTGGTGGCAGG + Intronic
1019009509 6:168831833-168831855 ATCAAGAAGAAGACGGTGATGGG - Intergenic
1019022054 6:168927568-168927590 GAAGAGAAGGAGGCGGTGGCAGG + Intergenic
1019230317 6:170554785-170554807 ATGGAGAAGAAGCGGATGGCAGG - Intronic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1021726151 7:23549883-23549905 ATAAAGAAAAAGAAGGAGGCCGG - Intergenic
1022650591 7:32270607-32270629 ATAGTGAAGAAGATAATGGCTGG + Intronic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023604310 7:41914724-41914746 AGAGGGAAGAAGGAGGTGGCTGG + Intergenic
1027161175 7:75803511-75803533 ATGCAGAAGAAGAGGGTAGCAGG - Intergenic
1027235522 7:76295467-76295489 ATAGAGAAGAAAATGCAGGCTGG - Intergenic
1027397108 7:77767669-77767691 AGAAAAGAGAAGACGGTGGCCGG - Intronic
1027453958 7:78364032-78364054 ATAGAGAAGAAGGAGGAGGGAGG - Intronic
1027529488 7:79312900-79312922 AAAGGGAAGAAGGCGGTGGGTGG - Intronic
1029303814 7:99604304-99604326 AGAGGGAAGGAGACAGTGGCTGG - Intronic
1029304898 7:99611868-99611890 ATAGAGATGAAGCCAGTGGAGGG - Intergenic
1030319760 7:108152936-108152958 ACAGAGAAAAAGATGGTGCCAGG + Intronic
1030899968 7:115111110-115111132 AGAGAAAAGAAGAGGGTGGAAGG - Intergenic
1031559175 7:123216905-123216927 ATAGAGAGGAAGGAGGTGCCAGG - Intergenic
1031769418 7:125824357-125824379 AGAGAGCAGGAGACGGTGGAGGG + Intergenic
1031798677 7:126213691-126213713 ATAGAGGACAAAACGGTGGAAGG - Intergenic
1037151999 8:15648428-15648450 TTAAAGAATAAGACGTTGGCTGG + Intronic
1037680168 8:21090493-21090515 AAAGAGACGAACAGGGTGGCGGG - Intergenic
1038328141 8:26587884-26587906 ATAGAGGGGAAGACTGAGGCCGG + Intronic
1039341664 8:36657490-36657512 ATAGAAATGAAGGCAGTGGCAGG - Intergenic
1043095248 8:75960890-75960912 ATAGAGAAGAAGATGGGATCTGG - Intergenic
1043156941 8:76794843-76794865 ATAGAGATGGAGAAGGCGGCTGG + Intronic
1044264756 8:90168149-90168171 AAAGTGAAGAAGGCTGTGGCAGG + Intergenic
1045006234 8:97919108-97919130 CTAGAAAAGAAGATAGTGGCAGG - Intronic
1045066919 8:98456487-98456509 ATAAAGAAGATGACTGTGGTAGG + Intronic
1047783080 8:128125687-128125709 AGAGAGAAAATGACGGTGGGCGG + Intergenic
1047825353 8:128567591-128567613 GGAGAGAATAAGACGATGGCAGG + Intergenic
1047932787 8:129747697-129747719 GAAGAGAACAAGATGGTGGCAGG + Intergenic
1048118609 8:131553802-131553824 ATGAAGAAGAAGGCAGTGGCTGG + Intergenic
1048190416 8:132282991-132283013 AAAGAAAGGAAGACAGTGGCTGG + Intronic
1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG + Intronic
1051430201 9:16973672-16973694 TTAGTGAAGAAGACAGTGGTGGG + Intergenic
1055527609 9:77151118-77151140 AAAGAGAAGAAGAGGGTAGATGG + Intergenic
1055690639 9:78826707-78826729 AGAGAGCAGAAGAGGGAGGCAGG + Intergenic
1055963568 9:81843524-81843546 ATAGAAGACAAGATGGTGGCCGG - Intergenic
1056848646 9:90062101-90062123 ATAGGGAAGAGGTAGGTGGCAGG - Intergenic
1057941983 9:99293061-99293083 ATACAGGAGAAGAGAGTGGCAGG + Intergenic
1058067581 9:100566429-100566451 ACTGAGATGAAGAAGGTGGCAGG - Intronic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059409783 9:114124713-114124735 CTAGAAAAGAAGACTGAGGCTGG + Intergenic
1059775081 9:117466113-117466135 ATAGAGAGGAAGAAGGAGGGAGG + Intergenic
1060871661 9:127047400-127047422 ATAGAGAAAAAAAAGATGGCCGG + Intronic
1062133895 9:134914612-134914634 AGAGAGAGAAAGACAGTGGCAGG - Intronic
1189160736 X:38805673-38805695 AGAGAGAAGAAAATGGTGGCCGG + Exonic
1190436695 X:50432866-50432888 ATAGAAAAGAAGAAGGGGGGAGG - Intronic
1197358536 X:125467937-125467959 ATAGAGGAGAAGTCAGTGTCTGG - Intergenic
1197473826 X:126895408-126895430 AAAGAGGAGAAGACAGTGCCTGG + Intergenic
1198003699 X:132469099-132469121 ATAGAGAAGAATACCGTGGATGG + Intronic
1198649017 X:138840482-138840504 GTAGAGAAGTATACAGTGGCAGG - Intronic
1198747758 X:139907450-139907472 ATAGAAAAGAAGCTGCTGGCCGG + Intronic
1200227961 X:154429483-154429505 ATAGATGAGAAGACTGAGGCTGG + Intronic
1201225446 Y:11814088-11814110 AGAGAGAAAAAGACTGTGGAAGG - Intergenic